Incidental Mutation 'R3081:Fastkd3'
ID265451
Institutional Source Beutler Lab
Gene Symbol Fastkd3
Ensembl Gene ENSMUSG00000021532
Gene NameFAST kinase domains 3
Synonyms2310010B21Rik
MMRRC Submission 040571-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R3081 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location68582234-68592338 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 68584868 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 436 (V436A)
Ref Sequence ENSEMBL: ENSMUSP00000152635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045827] [ENSMUST00000051784] [ENSMUST00000220973] [ENSMUST00000221259] [ENSMUST00000222107] [ENSMUST00000222631] [ENSMUST00000222660] [ENSMUST00000223101] [ENSMUST00000223187] [ENSMUST00000223319] [ENSMUST00000223398]
Predicted Effect probably benign
Transcript: ENSMUST00000045827
SMART Domains Protein: ENSMUSP00000039810
Gene: ENSMUSG00000034617

DomainStartEndE-ValueType
Pfam:Flavodoxin_5 5 126 2.7e-9 PFAM
Pfam:Flavodoxin_1 6 142 4.3e-32 PFAM
Pfam:FAD_binding_1 267 490 2.6e-51 PFAM
Pfam:NAD_binding_1 540 660 5.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000051784
AA Change: V436A

PolyPhen 2 Score 0.385 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000061737
Gene: ENSMUSG00000021532
AA Change: V436A

DomainStartEndE-ValueType
low complexity region 178 189 N/A INTRINSIC
Pfam:FAST_1 410 478 2.9e-22 PFAM
Pfam:FAST_2 491 581 3.1e-28 PFAM
RAP 594 651 7.58e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220973
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221006
Predicted Effect probably benign
Transcript: ENSMUST00000221259
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221800
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222068
Predicted Effect probably benign
Transcript: ENSMUST00000222107
Predicted Effect probably benign
Transcript: ENSMUST00000222631
Predicted Effect probably benign
Transcript: ENSMUST00000222660
Predicted Effect unknown
Transcript: ENSMUST00000222685
AA Change: V15A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223055
Predicted Effect probably benign
Transcript: ENSMUST00000223101
Predicted Effect probably benign
Transcript: ENSMUST00000223187
Predicted Effect probably benign
Transcript: ENSMUST00000223319
AA Change: V436A

PolyPhen 2 Score 0.385 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000223398
Meta Mutation Damage Score 0.154 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a small family of Fas-activated serine/threonine kinase domain (FASTKD) containing proteins that share an amino terminal mitochondrial targeting domain and multiple carboxy terminal FAST domains as well as a putative RNA-binding RAP domain. The members of this family are ubiquitously expressed and are generally most abundant in mitochondria-enriched tissues such as heart, skeletal muscle and brown-adipose tissue. Some members of this protein family may play a role in apoptosis. The protein encoded by this gene interacts with components of the mitochondrial respiratory and translation networks. A pseudogene of this gene is also present on chromosome 5. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamdc T A 7: 97,565,225 T48S probably benign Het
Abcc3 T A 11: 94,356,976 L1230F probably damaging Het
Abcf3 T A 16: 20,559,364 I542N probably benign Het
Als2 A G 1: 59,187,349 L932P probably damaging Het
Arhgap45 G A 10: 80,026,447 R583H probably damaging Het
Asl T C 5: 130,013,404 Y277C probably damaging Het
Bcl9 A T 3: 97,205,673 N1155K possibly damaging Het
Carm1 C A 9: 21,579,396 probably null Het
Cdkn2aip T C 8: 47,711,497 K394E probably damaging Het
Cfap70 A G 14: 20,420,762 Y472H probably damaging Het
Cfap77 T A 2: 28,962,650 K203N probably damaging Het
Cldn14 T C 16: 93,919,304 K218R probably damaging Het
Coro6 T C 11: 77,468,912 F336S probably damaging Het
Derl1 C A 15: 57,875,611 probably benign Het
Dixdc1 G A 9: 50,710,959 A25V probably damaging Het
Dock2 T A 11: 34,231,610 H1651L probably benign Het
Dock6 A G 9: 21,839,200 F473L possibly damaging Het
Dzip3 T C 16: 48,927,558 H1163R probably damaging Het
Efcab9 T C 11: 32,523,689 D35G probably benign Het
Evpl T C 11: 116,220,852 D2004G probably damaging Het
Faiml A G 9: 99,232,474 C121R probably damaging Het
Fbxl5 A G 5: 43,750,880 Y660H probably damaging Het
Glt8d1 T C 14: 31,006,660 V15A probably benign Het
Gpr25 A C 1: 136,259,885 I330S possibly damaging Het
Hdac5 A T 11: 102,205,610 V257E probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Lrriq1 T A 10: 103,144,889 S1462C probably damaging Het
Mgat3 A G 15: 80,211,854 D294G probably benign Het
Mylk2 A G 2: 152,919,354 N459S probably benign Het
Myo3b A C 2: 70,256,583 probably benign Het
Naip6 T C 13: 100,300,453 T521A probably benign Het
Nfxl1 C T 5: 72,529,035 A608T possibly damaging Het
Nmd3 A G 3: 69,724,399 probably benign Het
Nol8 C T 13: 49,678,392 probably benign Het
Olfr389 A T 11: 73,777,225 M34K probably damaging Het
Olfr870 C A 9: 20,170,765 G269W probably benign Het
Olfr901 T A 9: 38,431,056 M258K possibly damaging Het
Olfr954 G A 9: 39,461,930 M166I probably benign Het
Pcdhgb2 T C 18: 37,691,513 F519S probably damaging Het
Phf11c A G 14: 59,381,484 V284A probably benign Het
Rasl11a G T 5: 146,847,303 C186F probably benign Het
Rps18-ps3 T C 8: 107,262,837 noncoding transcript Het
Rusc1 A G 3: 89,091,723 S251P possibly damaging Het
Rxfp3 T C 15: 11,037,217 E23G probably benign Het
Senp6 G A 9: 80,143,842 A1134T probably benign Het
Slc22a4 A G 11: 54,007,789 V159A probably benign Het
Spata31d1a T C 13: 59,703,093 N407S probably benign Het
Ssc4d T C 5: 135,965,724 T51A possibly damaging Het
Stip1 C T 19: 7,035,648 A23T probably benign Het
Tecta A T 9: 42,377,994 M425K possibly damaging Het
Tmed4 T C 11: 6,274,151 H115R probably benign Het
Tmem255b T A 8: 13,451,048 L74H probably damaging Het
Trav6n-5 A T 14: 53,105,284 H93L possibly damaging Het
Tsen54 T A 11: 115,820,164 D187E probably benign Het
Ttc39d A G 17: 80,217,553 Y547C probably damaging Het
Vmn2r88 A G 14: 51,418,632 N775S probably damaging Het
Vps13a G T 19: 16,664,737 N2175K probably benign Het
Wnk4 A G 11: 101,276,891 probably benign Het
Zfp180 A T 7: 24,105,503 Q449L probably damaging Het
Other mutations in Fastkd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Fastkd3 APN 13 68584528 missense possibly damaging 0.87
IGL01839:Fastkd3 APN 13 68584852 missense probably benign 0.19
IGL02268:Fastkd3 APN 13 68583677 missense probably damaging 0.96
IGL03412:Fastkd3 APN 13 68583721 missense probably benign 0.01
R0681:Fastkd3 UTSW 13 68591928 splice site probably benign
R1282:Fastkd3 UTSW 13 68584557 missense possibly damaging 0.76
R1987:Fastkd3 UTSW 13 68585241 missense possibly damaging 0.92
R4153:Fastkd3 UTSW 13 68590138 missense probably damaging 1.00
R5339:Fastkd3 UTSW 13 68590164 missense probably damaging 1.00
R5384:Fastkd3 UTSW 13 68584585 missense probably benign 0.09
R6034:Fastkd3 UTSW 13 68583610 missense probably damaging 0.99
R6034:Fastkd3 UTSW 13 68583610 missense probably damaging 0.99
R6109:Fastkd3 UTSW 13 68590218 nonsense probably null
R6123:Fastkd3 UTSW 13 68590218 nonsense probably null
R6124:Fastkd3 UTSW 13 68590218 nonsense probably null
R6299:Fastkd3 UTSW 13 68587736 missense probably damaging 0.97
R6388:Fastkd3 UTSW 13 68590200 missense probably damaging 1.00
R6561:Fastkd3 UTSW 13 68584030 missense possibly damaging 0.95
R7214:Fastkd3 UTSW 13 68589380 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- CTGCAGCAGGAAACGGATTCTC -3'
(R):5'- TACTTCCGGAGCAAGCAGTC -3'

Sequencing Primer
(F):5'- GCAGGAAACGGATTCTCTCCAAG -3'
(R):5'- ACACTGGAGCTCTCAGTGTAAGC -3'
Posted On2015-02-05