Incidental Mutation 'R3081:Cfap70'
ID265452
Institutional Source Beutler Lab
Gene Symbol Cfap70
Ensembl Gene ENSMUSG00000039543
Gene Namecilia and flagella associated protein 70
Synonyms5330402L21Rik, Ttc18
MMRRC Submission 040571-MU
Accession Numbers

NCBI RefSeq: NM_001163638.1, NM_001163639.1, NM_029698.1; MGI: 1923920

Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R3081 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location20394193-20452226 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20420762 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 472 (Y472H)
Ref Sequence ENSEMBL: ENSMUSP00000022349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022348] [ENSMUST00000022349] [ENSMUST00000056073]
Predicted Effect probably damaging
Transcript: ENSMUST00000022348
AA Change: Y528H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022348
Gene: ENSMUSG00000039543
AA Change: Y528H

DomainStartEndE-ValueType
Blast:C2 11 122 5e-44 BLAST
low complexity region 494 503 N/A INTRINSIC
low complexity region 581 590 N/A INTRINSIC
Blast:TPR 591 623 2e-11 BLAST
Blast:TPR 624 657 3e-15 BLAST
TPR 658 691 1.73e1 SMART
Blast:TPR 693 724 2e-7 BLAST
TPR 905 938 1.26e1 SMART
TPR 939 972 5.03e-1 SMART
TPR 976 1009 2.52e-1 SMART
TPR 1043 1076 2.07e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000022349
AA Change: Y472H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022349
Gene: ENSMUSG00000039543
AA Change: Y472H

DomainStartEndE-ValueType
Blast:C2 11 122 5e-44 BLAST
low complexity region 438 447 N/A INTRINSIC
low complexity region 569 578 N/A INTRINSIC
Blast:TPR 579 611 2e-11 BLAST
Blast:TPR 612 645 3e-15 BLAST
TPR 646 679 1.73e1 SMART
Blast:TPR 681 712 2e-7 BLAST
TPR 932 965 1.26e1 SMART
TPR 966 999 5.03e-1 SMART
TPR 1003 1036 2.52e-1 SMART
TPR 1070 1103 2.07e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000056073
AA Change: Y528H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000056869
Gene: ENSMUSG00000039543
AA Change: Y528H

DomainStartEndE-ValueType
Blast:C2 11 122 5e-44 BLAST
low complexity region 494 503 N/A INTRINSIC
low complexity region 625 634 N/A INTRINSIC
Blast:TPR 635 667 2e-11 BLAST
Blast:TPR 668 701 3e-15 BLAST
TPR 702 735 1.73e1 SMART
Blast:TPR 737 768 2e-7 BLAST
TPR 949 982 1.26e1 SMART
TPR 983 1016 5.03e-1 SMART
TPR 1020 1053 2.52e-1 SMART
TPR 1087 1120 2.07e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141432
Predicted Effect probably damaging
Transcript: ENSMUST00000144797
AA Change: Y528H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116668
Gene: ENSMUSG00000039543
AA Change: Y528H

DomainStartEndE-ValueType
Blast:C2 11 122 5e-44 BLAST
low complexity region 494 503 N/A INTRINSIC
low complexity region 630 639 N/A INTRINSIC
Blast:TPR 640 672 2e-11 BLAST
Blast:TPR 673 706 3e-15 BLAST
TPR 707 740 1.73e1 SMART
Blast:TPR 742 773 2e-7 BLAST
TPR 954 987 1.26e1 SMART
TPR 988 1021 5.03e-1 SMART
TPR 1025 1058 2.52e-1 SMART
TPR 1092 1125 2.07e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148692
Meta Mutation Damage Score 0.18 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (58/58)
Allele List at MGI

All alleles(17) : Targeted(2) Gene trapped(15)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamdc T A 7: 97,565,225 T48S probably benign Het
Abcc3 T A 11: 94,356,976 L1230F probably damaging Het
Abcf3 T A 16: 20,559,364 I542N probably benign Het
Als2 A G 1: 59,187,349 L932P probably damaging Het
Arhgap45 G A 10: 80,026,447 R583H probably damaging Het
Asl T C 5: 130,013,404 Y277C probably damaging Het
Bcl9 A T 3: 97,205,673 N1155K possibly damaging Het
Carm1 C A 9: 21,579,396 probably null Het
Cdkn2aip T C 8: 47,711,497 K394E probably damaging Het
Cfap77 T A 2: 28,962,650 K203N probably damaging Het
Cldn14 T C 16: 93,919,304 K218R probably damaging Het
Coro6 T C 11: 77,468,912 F336S probably damaging Het
Derl1 C A 15: 57,875,611 probably benign Het
Dixdc1 G A 9: 50,710,959 A25V probably damaging Het
Dock2 T A 11: 34,231,610 H1651L probably benign Het
Dock6 A G 9: 21,839,200 F473L possibly damaging Het
Dzip3 T C 16: 48,927,558 H1163R probably damaging Het
Efcab9 T C 11: 32,523,689 D35G probably benign Het
Evpl T C 11: 116,220,852 D2004G probably damaging Het
Faiml A G 9: 99,232,474 C121R probably damaging Het
Fastkd3 T C 13: 68,584,868 V436A probably benign Het
Fbxl5 A G 5: 43,750,880 Y660H probably damaging Het
Glt8d1 T C 14: 31,006,660 V15A probably benign Het
Gpr25 A C 1: 136,259,885 I330S possibly damaging Het
Hdac5 A T 11: 102,205,610 V257E probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Lrriq1 T A 10: 103,144,889 S1462C probably damaging Het
Mgat3 A G 15: 80,211,854 D294G probably benign Het
Mylk2 A G 2: 152,919,354 N459S probably benign Het
Myo3b A C 2: 70,256,583 probably benign Het
Naip6 T C 13: 100,300,453 T521A probably benign Het
Nfxl1 C T 5: 72,529,035 A608T possibly damaging Het
Nmd3 A G 3: 69,724,399 probably benign Het
Nol8 C T 13: 49,678,392 probably benign Het
Olfr389 A T 11: 73,777,225 M34K probably damaging Het
Olfr870 C A 9: 20,170,765 G269W probably benign Het
Olfr901 T A 9: 38,431,056 M258K possibly damaging Het
Olfr954 G A 9: 39,461,930 M166I probably benign Het
Pcdhgb2 T C 18: 37,691,513 F519S probably damaging Het
Phf11c A G 14: 59,381,484 V284A probably benign Het
Rasl11a G T 5: 146,847,303 C186F probably benign Het
Rps18-ps3 T C 8: 107,262,837 noncoding transcript Het
Rusc1 A G 3: 89,091,723 S251P possibly damaging Het
Rxfp3 T C 15: 11,037,217 E23G probably benign Het
Senp6 G A 9: 80,143,842 A1134T probably benign Het
Slc22a4 A G 11: 54,007,789 V159A probably benign Het
Spata31d1a T C 13: 59,703,093 N407S probably benign Het
Ssc4d T C 5: 135,965,724 T51A possibly damaging Het
Stip1 C T 19: 7,035,648 A23T probably benign Het
Tecta A T 9: 42,377,994 M425K possibly damaging Het
Tmed4 T C 11: 6,274,151 H115R probably benign Het
Tmem255b T A 8: 13,451,048 L74H probably damaging Het
Trav6n-5 A T 14: 53,105,284 H93L possibly damaging Het
Tsen54 T A 11: 115,820,164 D187E probably benign Het
Ttc39d A G 17: 80,217,553 Y547C probably damaging Het
Vmn2r88 A G 14: 51,418,632 N775S probably damaging Het
Vps13a G T 19: 16,664,737 N2175K probably benign Het
Wnk4 A G 11: 101,276,891 probably benign Het
Zfp180 A T 7: 24,105,503 Q449L probably damaging Het
Other mutations in Cfap70
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Cfap70 APN 14 20412462 missense possibly damaging 0.77
IGL00567:Cfap70 APN 14 20394680 missense probably benign 0.30
IGL00773:Cfap70 APN 14 20447534 missense probably damaging 1.00
IGL01061:Cfap70 APN 14 20447625 splice site probably benign
IGL01520:Cfap70 APN 14 20420687 missense probably benign 0.23
IGL01665:Cfap70 APN 14 20403118 missense probably damaging 1.00
IGL01918:Cfap70 APN 14 20425399 missense possibly damaging 0.81
IGL02211:Cfap70 APN 14 20394972 missense probably damaging 1.00
IGL02613:Cfap70 APN 14 20409064 unclassified probably null
IGL03142:Cfap70 APN 14 20397215 missense probably damaging 0.99
IGL03354:Cfap70 APN 14 20431982 missense probably damaging 1.00
IGL03047:Cfap70 UTSW 14 20448578 missense possibly damaging 0.92
IGL03097:Cfap70 UTSW 14 20448608 missense probably benign 0.00
P0008:Cfap70 UTSW 14 20416532 missense probably damaging 0.99
P0035:Cfap70 UTSW 14 20424471 splice site probably benign
R0200:Cfap70 UTSW 14 20448563 missense probably damaging 0.96
R0207:Cfap70 UTSW 14 20412347 missense probably damaging 1.00
R0238:Cfap70 UTSW 14 20448605 missense probably benign 0.01
R0238:Cfap70 UTSW 14 20448605 missense probably benign 0.01
R0239:Cfap70 UTSW 14 20448605 missense probably benign 0.01
R0239:Cfap70 UTSW 14 20448605 missense probably benign 0.01
R0463:Cfap70 UTSW 14 20448563 missense probably damaging 0.96
R0608:Cfap70 UTSW 14 20448563 missense probably damaging 0.96
R0703:Cfap70 UTSW 14 20439715 missense probably damaging 1.00
R0919:Cfap70 UTSW 14 20404164 missense probably benign 0.00
R0928:Cfap70 UTSW 14 20443919 missense probably damaging 1.00
R1595:Cfap70 UTSW 14 20447536 missense probably benign 0.10
R1667:Cfap70 UTSW 14 20404157 missense probably benign 0.41
R1799:Cfap70 UTSW 14 20394999 missense probably damaging 1.00
R1869:Cfap70 UTSW 14 20408610 nonsense probably null
R1920:Cfap70 UTSW 14 20394952 missense probably damaging 1.00
R1968:Cfap70 UTSW 14 20420811 missense possibly damaging 0.93
R2173:Cfap70 UTSW 14 20408562 missense probably benign 0.00
R3813:Cfap70 UTSW 14 20421122 missense possibly damaging 0.95
R3979:Cfap70 UTSW 14 20439719 missense probably benign 0.11
R4093:Cfap70 UTSW 14 20409113 missense probably damaging 1.00
R4271:Cfap70 UTSW 14 20420725 missense probably benign 0.00
R4604:Cfap70 UTSW 14 20443661 missense probably benign 0.01
R4839:Cfap70 UTSW 14 20425529 missense probably damaging 0.96
R6387:Cfap70 UTSW 14 20448575 missense probably damaging 1.00
R6464:Cfap70 UTSW 14 20401039 intron probably null
R6915:Cfap70 UTSW 14 20409085 missense probably benign 0.17
R7317:Cfap70 UTSW 14 20400434 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- GTTCCACTGGCTGATAGAAAAC -3'
(R):5'- AAGCTCTTCAGTGTGGCTTC -3'

Sequencing Primer
(F):5'- CCACTGGCTGATAGAAAACTTAAAG -3'
(R):5'- GCATCTGTGATCAATGAATCCTGTGC -3'
Posted On2015-02-05