Incidental Mutation 'R3081:Mgat3'
ID265458
Institutional Source Beutler Lab
Gene Symbol Mgat3
Ensembl Gene ENSMUSG00000042428
Gene Namemannoside acetylglucosaminyltransferase 3
SynonymsGnT-III, 1110038J12Rik
MMRRC Submission 040571-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.328) question?
Stock #R3081 (G1)
Quality Score179
Status Validated
Chromosome15
Chromosomal Location80173721-80215519 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80211854 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 294 (D294G)
Ref Sequence ENSEMBL: ENSMUSP00000043077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044970]
Predicted Effect probably benign
Transcript: ENSMUST00000044970
AA Change: D294G

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000043077
Gene: ENSMUSG00000042428
AA Change: D294G

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
low complexity region 73 87 N/A INTRINSIC
Pfam:Glyco_transf_17 191 362 3.2e-28 PFAM
Meta Mutation Damage Score 0.364 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] There are believed to be over 100 different glycosyltransferases involved in the synthesis of protein-bound and lipid-bound oligosaccharides. The enzyme encoded by this gene transfers a GlcNAc residue to the beta-linked mannose of the trimannosyl core of N-linked oligosaccharides and produces a bisecting GlcNAc. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit reduced DEN and PB-induced hepatic tumors and reduced hepatocyte proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamdc T A 7: 97,565,225 T48S probably benign Het
Abcc3 T A 11: 94,356,976 L1230F probably damaging Het
Abcf3 T A 16: 20,559,364 I542N probably benign Het
Als2 A G 1: 59,187,349 L932P probably damaging Het
Arhgap45 G A 10: 80,026,447 R583H probably damaging Het
Asl T C 5: 130,013,404 Y277C probably damaging Het
Bcl9 A T 3: 97,205,673 N1155K possibly damaging Het
Carm1 C A 9: 21,579,396 probably null Het
Cdkn2aip T C 8: 47,711,497 K394E probably damaging Het
Cfap70 A G 14: 20,420,762 Y472H probably damaging Het
Cfap77 T A 2: 28,962,650 K203N probably damaging Het
Cldn14 T C 16: 93,919,304 K218R probably damaging Het
Coro6 T C 11: 77,468,912 F336S probably damaging Het
Derl1 C A 15: 57,875,611 probably benign Het
Dixdc1 G A 9: 50,710,959 A25V probably damaging Het
Dock2 T A 11: 34,231,610 H1651L probably benign Het
Dock6 A G 9: 21,839,200 F473L possibly damaging Het
Dzip3 T C 16: 48,927,558 H1163R probably damaging Het
Efcab9 T C 11: 32,523,689 D35G probably benign Het
Evpl T C 11: 116,220,852 D2004G probably damaging Het
Faiml A G 9: 99,232,474 C121R probably damaging Het
Fastkd3 T C 13: 68,584,868 V436A probably benign Het
Fbxl5 A G 5: 43,750,880 Y660H probably damaging Het
Glt8d1 T C 14: 31,006,660 V15A probably benign Het
Gpr25 A C 1: 136,259,885 I330S possibly damaging Het
Hdac5 A T 11: 102,205,610 V257E probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Lrriq1 T A 10: 103,144,889 S1462C probably damaging Het
Mylk2 A G 2: 152,919,354 N459S probably benign Het
Myo3b A C 2: 70,256,583 probably benign Het
Naip6 T C 13: 100,300,453 T521A probably benign Het
Nfxl1 C T 5: 72,529,035 A608T possibly damaging Het
Nmd3 A G 3: 69,724,399 probably benign Het
Nol8 C T 13: 49,678,392 probably benign Het
Olfr389 A T 11: 73,777,225 M34K probably damaging Het
Olfr870 C A 9: 20,170,765 G269W probably benign Het
Olfr901 T A 9: 38,431,056 M258K possibly damaging Het
Olfr954 G A 9: 39,461,930 M166I probably benign Het
Pcdhgb2 T C 18: 37,691,513 F519S probably damaging Het
Phf11c A G 14: 59,381,484 V284A probably benign Het
Rasl11a G T 5: 146,847,303 C186F probably benign Het
Rps18-ps3 T C 8: 107,262,837 noncoding transcript Het
Rusc1 A G 3: 89,091,723 S251P possibly damaging Het
Rxfp3 T C 15: 11,037,217 E23G probably benign Het
Senp6 G A 9: 80,143,842 A1134T probably benign Het
Slc22a4 A G 11: 54,007,789 V159A probably benign Het
Spata31d1a T C 13: 59,703,093 N407S probably benign Het
Ssc4d T C 5: 135,965,724 T51A possibly damaging Het
Stip1 C T 19: 7,035,648 A23T probably benign Het
Tecta A T 9: 42,377,994 M425K possibly damaging Het
Tmed4 T C 11: 6,274,151 H115R probably benign Het
Tmem255b T A 8: 13,451,048 L74H probably damaging Het
Trav6n-5 A T 14: 53,105,284 H93L possibly damaging Het
Tsen54 T A 11: 115,820,164 D187E probably benign Het
Ttc39d A G 17: 80,217,553 Y547C probably damaging Het
Vmn2r88 A G 14: 51,418,632 N775S probably damaging Het
Vps13a G T 19: 16,664,737 N2175K probably benign Het
Wnk4 A G 11: 101,276,891 probably benign Het
Zfp180 A T 7: 24,105,503 Q449L probably damaging Het
Other mutations in Mgat3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Mgat3 APN 15 80212433 missense probably damaging 1.00
IGL01134:Mgat3 APN 15 80212176 missense probably benign 0.17
R0077:Mgat3 UTSW 15 80212577 missense probably benign 0.00
R1171:Mgat3 UTSW 15 80211637 missense probably benign 0.26
R1885:Mgat3 UTSW 15 80211619 missense probably benign 0.25
R1886:Mgat3 UTSW 15 80211619 missense probably benign 0.25
R1986:Mgat3 UTSW 15 80212189 missense probably benign 0.04
R2125:Mgat3 UTSW 15 80211886 missense probably benign 0.00
R4819:Mgat3 UTSW 15 80212349 missense probably damaging 1.00
R4992:Mgat3 UTSW 15 80212542 missense probably benign
R5083:Mgat3 UTSW 15 80211298 missense possibly damaging 0.92
R5356:Mgat3 UTSW 15 80211610 missense possibly damaging 0.88
R5356:Mgat3 UTSW 15 80212454 missense probably damaging 1.00
R6508:Mgat3 UTSW 15 80212024 missense possibly damaging 0.90
R6784:Mgat3 UTSW 15 80212200 missense probably damaging 0.98
R7021:Mgat3 UTSW 15 80212454 missense probably damaging 1.00
R7056:Mgat3 UTSW 15 80211896 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GATGTGCGTTTCCATGAGC -3'
(R):5'- GGCTGCTTCCAGAAGAAACC -3'

Sequencing Primer
(F):5'- CGTTTCCATGAGCTGGGAG -3'
(R):5'- CATACAGGGACTTCCGCATGTG -3'
Posted On2015-02-05