Incidental Mutation 'R3081:Cldn14'
ID265461
Institutional Source Beutler Lab
Gene Symbol Cldn14
Ensembl Gene ENSMUSG00000047109
Gene Nameclaudin 14
Synonyms
MMRRC Submission 040571-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R3081 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location93919031-94008837 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93919304 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 218 (K218R)
Ref Sequence ENSEMBL: ENSMUSP00000136156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050962] [ENSMUST00000137163] [ENSMUST00000142083] [ENSMUST00000169391] [ENSMUST00000177648]
Predicted Effect probably damaging
Transcript: ENSMUST00000050962
AA Change: K218R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062045
Gene: ENSMUSG00000047109
AA Change: K218R

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 181 3.3e-31 PFAM
low complexity region 199 217 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137163
Predicted Effect probably benign
Transcript: ENSMUST00000142083
Predicted Effect probably damaging
Transcript: ENSMUST00000169391
AA Change: K218R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126455
Gene: ENSMUSG00000047109
AA Change: K218R

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 181 3.3e-31 PFAM
Pfam:Claudin_2 15 183 1.1e-12 PFAM
low complexity region 199 217 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177648
AA Change: K218R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136156
Gene: ENSMUSG00000047109
AA Change: K218R

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 181 3.3e-31 PFAM
Pfam:Claudin_2 15 183 1.1e-12 PFAM
low complexity region 199 217 N/A INTRINSIC
Meta Mutation Damage Score 0.1 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: This gene encodes a member of the claudin family of tight junction proteins. The encoded protein is an integral membrane protein that may function in maintaining apical membrane polarization in tight junctions located between outer hair cells and supporting cells. Loss of function of this gene is associated with hearing problems. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutant mice have a normal endocochlear potential but are deaf due to cochlear hair cell degeneration within the first 3 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamdc T A 7: 97,565,225 T48S probably benign Het
Abcc3 T A 11: 94,356,976 L1230F probably damaging Het
Abcf3 T A 16: 20,559,364 I542N probably benign Het
Als2 A G 1: 59,187,349 L932P probably damaging Het
Arhgap45 G A 10: 80,026,447 R583H probably damaging Het
Asl T C 5: 130,013,404 Y277C probably damaging Het
Bcl9 A T 3: 97,205,673 N1155K possibly damaging Het
Carm1 C A 9: 21,579,396 probably null Het
Cdkn2aip T C 8: 47,711,497 K394E probably damaging Het
Cfap70 A G 14: 20,420,762 Y472H probably damaging Het
Cfap77 T A 2: 28,962,650 K203N probably damaging Het
Coro6 T C 11: 77,468,912 F336S probably damaging Het
Derl1 C A 15: 57,875,611 probably benign Het
Dixdc1 G A 9: 50,710,959 A25V probably damaging Het
Dock2 T A 11: 34,231,610 H1651L probably benign Het
Dock6 A G 9: 21,839,200 F473L possibly damaging Het
Dzip3 T C 16: 48,927,558 H1163R probably damaging Het
Efcab9 T C 11: 32,523,689 D35G probably benign Het
Evpl T C 11: 116,220,852 D2004G probably damaging Het
Faiml A G 9: 99,232,474 C121R probably damaging Het
Fastkd3 T C 13: 68,584,868 V436A probably benign Het
Fbxl5 A G 5: 43,750,880 Y660H probably damaging Het
Glt8d1 T C 14: 31,006,660 V15A probably benign Het
Gpr25 A C 1: 136,259,885 I330S possibly damaging Het
Hdac5 A T 11: 102,205,610 V257E probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Lrriq1 T A 10: 103,144,889 S1462C probably damaging Het
Mgat3 A G 15: 80,211,854 D294G probably benign Het
Mylk2 A G 2: 152,919,354 N459S probably benign Het
Myo3b A C 2: 70,256,583 probably benign Het
Naip6 T C 13: 100,300,453 T521A probably benign Het
Nfxl1 C T 5: 72,529,035 A608T possibly damaging Het
Nmd3 A G 3: 69,724,399 probably benign Het
Nol8 C T 13: 49,678,392 probably benign Het
Olfr389 A T 11: 73,777,225 M34K probably damaging Het
Olfr870 C A 9: 20,170,765 G269W probably benign Het
Olfr901 T A 9: 38,431,056 M258K possibly damaging Het
Olfr954 G A 9: 39,461,930 M166I probably benign Het
Pcdhgb2 T C 18: 37,691,513 F519S probably damaging Het
Phf11c A G 14: 59,381,484 V284A probably benign Het
Rasl11a G T 5: 146,847,303 C186F probably benign Het
Rps18-ps3 T C 8: 107,262,837 noncoding transcript Het
Rusc1 A G 3: 89,091,723 S251P possibly damaging Het
Rxfp3 T C 15: 11,037,217 E23G probably benign Het
Senp6 G A 9: 80,143,842 A1134T probably benign Het
Slc22a4 A G 11: 54,007,789 V159A probably benign Het
Spata31d1a T C 13: 59,703,093 N407S probably benign Het
Ssc4d T C 5: 135,965,724 T51A possibly damaging Het
Stip1 C T 19: 7,035,648 A23T probably benign Het
Tecta A T 9: 42,377,994 M425K possibly damaging Het
Tmed4 T C 11: 6,274,151 H115R probably benign Het
Tmem255b T A 8: 13,451,048 L74H probably damaging Het
Trav6n-5 A T 14: 53,105,284 H93L possibly damaging Het
Tsen54 T A 11: 115,820,164 D187E probably benign Het
Ttc39d A G 17: 80,217,553 Y547C probably damaging Het
Vmn2r88 A G 14: 51,418,632 N775S probably damaging Het
Vps13a G T 19: 16,664,737 N2175K probably benign Het
Wnk4 A G 11: 101,276,891 probably benign Het
Zfp180 A T 7: 24,105,503 Q449L probably damaging Het
Other mutations in Cldn14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Cldn14 APN 16 93919301 missense probably benign 0.32
IGL02510:Cldn14 APN 16 93919956 start codon destroyed probably damaging 1.00
R1663:Cldn14 UTSW 16 93919278 missense probably damaging 1.00
R2939:Cldn14 UTSW 16 93919304 missense probably damaging 1.00
R4887:Cldn14 UTSW 16 93919859 missense possibly damaging 0.93
R6278:Cldn14 UTSW 16 93919598 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- AGCTCTTATTAAGCCACCCG -3'
(R):5'- AGTTTGAAATCGGCCAGGC -3'

Sequencing Primer
(F):5'- AGAAGTCTTTGCTTTGAAGAGC -3'
(R):5'- CCCTGTACCTGGGCTTCATC -3'
Posted On2015-02-05