Incidental Mutation 'R3081:Stip1'
ID265463
Institutional Source Beutler Lab
Gene Symbol Stip1
Ensembl Gene ENSMUSG00000024966
Gene Namestress-induced phosphoprotein 1
SynonymsHop, IEF SSP 3521, Hsp70/Hsp90 organizing protein, STI1, p60
MMRRC Submission 040571-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3081 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location7020696-7040026 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 7035648 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 23 (A23T)
Ref Sequence ENSEMBL: ENSMUSP00000025918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025918]
Predicted Effect probably benign
Transcript: ENSMUST00000025918
AA Change: A23T

PolyPhen 2 Score 0.419 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000025918
Gene: ENSMUSG00000024966
AA Change: A23T

DomainStartEndE-ValueType
TPR 4 37 3.07e-5 SMART
TPR 38 71 1.63e0 SMART
TPR 72 105 5.87e-2 SMART
STI1 130 169 4.84e-1 SMART
low complexity region 192 220 N/A INTRINSIC
TPR 225 258 7.45e-4 SMART
TPR 259 292 1.1e-1 SMART
TPR 300 333 1.09e-5 SMART
TPR 360 393 1.07e-4 SMART
TPR 394 427 9.45e-6 SMART
TPR 428 461 3.29e-5 SMART
STI1 492 531 1.66e-9 SMART
Meta Mutation Damage Score 0.328 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] STIP1 is an adaptor protein that coordinates the functions of HSP70 (see HSPA1A; MIM 140550) and HSP90 (see HSP90AA1; MIM 140571) in protein folding. It is thought to assist in the transfer of proteins from HSP70 to HSP90 by binding both HSP90 and substrate-bound HSP70. STIP1 also stimulates the ATPase activity of HSP70 and inhibits the ATPase activity of HSP90, suggesting that it regulates both the conformations and ATPase cycles of these chaperones (Song and Masison, 2005 [PubMed 16100115]).[supplied by OMIM, Jul 2009]
PHENOTYPE: Mice homozygous for a targeted allele exhibit embryonic lethality by E10.5, actute inflammation in the placental labyrinth, poorly formed neural tube and limb buds and increase double-strand breaks. Mice heterozygous for this allele exhibit susceptibility to ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamdc T A 7: 97,565,225 T48S probably benign Het
Abcc3 T A 11: 94,356,976 L1230F probably damaging Het
Abcf3 T A 16: 20,559,364 I542N probably benign Het
Als2 A G 1: 59,187,349 L932P probably damaging Het
Arhgap45 G A 10: 80,026,447 R583H probably damaging Het
Asl T C 5: 130,013,404 Y277C probably damaging Het
Bcl9 A T 3: 97,205,673 N1155K possibly damaging Het
Carm1 C A 9: 21,579,396 probably null Het
Cdkn2aip T C 8: 47,711,497 K394E probably damaging Het
Cfap70 A G 14: 20,420,762 Y472H probably damaging Het
Cfap77 T A 2: 28,962,650 K203N probably damaging Het
Cldn14 T C 16: 93,919,304 K218R probably damaging Het
Coro6 T C 11: 77,468,912 F336S probably damaging Het
Derl1 C A 15: 57,875,611 probably benign Het
Dixdc1 G A 9: 50,710,959 A25V probably damaging Het
Dock2 T A 11: 34,231,610 H1651L probably benign Het
Dock6 A G 9: 21,839,200 F473L possibly damaging Het
Dzip3 T C 16: 48,927,558 H1163R probably damaging Het
Efcab9 T C 11: 32,523,689 D35G probably benign Het
Evpl T C 11: 116,220,852 D2004G probably damaging Het
Faiml A G 9: 99,232,474 C121R probably damaging Het
Fastkd3 T C 13: 68,584,868 V436A probably benign Het
Fbxl5 A G 5: 43,750,880 Y660H probably damaging Het
Glt8d1 T C 14: 31,006,660 V15A probably benign Het
Gpr25 A C 1: 136,259,885 I330S possibly damaging Het
Hdac5 A T 11: 102,205,610 V257E probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Lrriq1 T A 10: 103,144,889 S1462C probably damaging Het
Mgat3 A G 15: 80,211,854 D294G probably benign Het
Mylk2 A G 2: 152,919,354 N459S probably benign Het
Myo3b A C 2: 70,256,583 probably benign Het
Naip6 T C 13: 100,300,453 T521A probably benign Het
Nfxl1 C T 5: 72,529,035 A608T possibly damaging Het
Nmd3 A G 3: 69,724,399 probably benign Het
Nol8 C T 13: 49,678,392 probably benign Het
Olfr389 A T 11: 73,777,225 M34K probably damaging Het
Olfr870 C A 9: 20,170,765 G269W probably benign Het
Olfr901 T A 9: 38,431,056 M258K possibly damaging Het
Olfr954 G A 9: 39,461,930 M166I probably benign Het
Pcdhgb2 T C 18: 37,691,513 F519S probably damaging Het
Phf11c A G 14: 59,381,484 V284A probably benign Het
Rasl11a G T 5: 146,847,303 C186F probably benign Het
Rps18-ps3 T C 8: 107,262,837 noncoding transcript Het
Rusc1 A G 3: 89,091,723 S251P possibly damaging Het
Rxfp3 T C 15: 11,037,217 E23G probably benign Het
Senp6 G A 9: 80,143,842 A1134T probably benign Het
Slc22a4 A G 11: 54,007,789 V159A probably benign Het
Spata31d1a T C 13: 59,703,093 N407S probably benign Het
Ssc4d T C 5: 135,965,724 T51A possibly damaging Het
Tecta A T 9: 42,377,994 M425K possibly damaging Het
Tmed4 T C 11: 6,274,151 H115R probably benign Het
Tmem255b T A 8: 13,451,048 L74H probably damaging Het
Trav6n-5 A T 14: 53,105,284 H93L possibly damaging Het
Tsen54 T A 11: 115,820,164 D187E probably benign Het
Ttc39d A G 17: 80,217,553 Y547C probably damaging Het
Vmn2r88 A G 14: 51,418,632 N775S probably damaging Het
Vps13a G T 19: 16,664,737 N2175K probably benign Het
Wnk4 A G 11: 101,276,891 probably benign Het
Zfp180 A T 7: 24,105,503 Q449L probably damaging Het
Other mutations in Stip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Stip1 APN 19 7021096 unclassified probably benign
IGL02506:Stip1 APN 19 7035489 splice site probably benign
IGL02515:Stip1 APN 19 7022119 missense probably benign 0.23
IGL03009:Stip1 APN 19 7021121 missense probably damaging 1.00
R1768:Stip1 UTSW 19 7021797 missense probably damaging 1.00
R4530:Stip1 UTSW 19 7035658 missense probably benign 0.04
R4965:Stip1 UTSW 19 7035570 missense probably benign 0.41
R5638:Stip1 UTSW 19 7032515 missense probably damaging 1.00
R5776:Stip1 UTSW 19 7022025 critical splice donor site probably null
R5840:Stip1 UTSW 19 7022068 missense possibly damaging 0.86
R7064:Stip1 UTSW 19 7035557 missense probably benign 0.18
R7096:Stip1 UTSW 19 7021810 missense possibly damaging 0.92
R7109:Stip1 UTSW 19 7021810 missense possibly damaging 0.92
R7111:Stip1 UTSW 19 7021810 missense possibly damaging 0.92
R7116:Stip1 UTSW 19 7021810 missense possibly damaging 0.92
R7117:Stip1 UTSW 19 7021810 missense possibly damaging 0.92
R7127:Stip1 UTSW 19 7021810 missense possibly damaging 0.92
R7129:Stip1 UTSW 19 7021810 missense possibly damaging 0.92
R7130:Stip1 UTSW 19 7021810 missense possibly damaging 0.92
R7132:Stip1 UTSW 19 7021810 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CAGGACAGGAGGACCTACTAATTAG -3'
(R):5'- TGATCAGTAGCAGCCAACTAG -3'

Sequencing Primer
(F):5'- TCCTTAGGAAACTGTACAGAGC -3'
(R):5'- GCCAACTAGCTGATACTTTGGAAG -3'
Posted On2015-02-05