Incidental Mutation 'R3085:Megf8'
ID265578
Institutional Source Beutler Lab
Gene Symbol Megf8
Ensembl Gene ENSMUSG00000045039
Gene Namemultiple EGF-like-domains 8
SynonymsEgfl4, b2b1702Clo, m687Ddg, b2b288Clo
MMRRC Submission 040574-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.929) question?
Stock #R3085 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location25317164-25365917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25349019 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 1706 (Y1706N)
Ref Sequence ENSEMBL: ENSMUSP00000122192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000128119]
Predicted Effect probably damaging
Transcript: ENSMUST00000128119
AA Change: Y1706N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122192
Gene: ENSMUSG00000045039
AA Change: Y1706N

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CUB 33 140 1.24e-15 SMART
EGF 141 170 4.26e0 SMART
EGF 173 203 2.43e1 SMART
Pfam:Kelch_4 227 277 1.3e-11 PFAM
Pfam:Kelch_3 240 287 1.6e-7 PFAM
low complexity region 320 341 N/A INTRINSIC
low complexity region 517 531 N/A INTRINSIC
low complexity region 728 738 N/A INTRINSIC
PSI 847 899 1.37e0 SMART
low complexity region 932 938 N/A INTRINSIC
PSI 949 991 2.11e-2 SMART
PSI 1005 1073 7.82e-1 SMART
EGF_CA 1074 1115 2.62e-9 SMART
EGF 1117 1160 5.4e-2 SMART
EGF_like 1163 1208 4e-1 SMART
EGF_Lam 1211 1259 1.03e-7 SMART
Blast:CUB 1263 1401 1e-30 BLAST
EGF_like 1406 1445 3.29e1 SMART
Pfam:Kelch_4 1509 1564 6.5e-12 PFAM
Pfam:Kelch_3 1520 1574 1.2e-10 PFAM
PSI 1868 1923 2.75e-1 SMART
PSI 2004 2062 1.6e0 SMART
PSI 2064 2121 1.68e-5 SMART
EGF 2125 2164 1.08e-1 SMART
EGF 2166 2194 4.26e0 SMART
EGF 2204 2244 2.2e1 SMART
EGF_like 2248 2321 6.37e-1 SMART
low complexity region 2493 2504 N/A INTRINSIC
low complexity region 2530 2541 N/A INTRINSIC
transmembrane domain 2592 2614 N/A INTRINSIC
low complexity region 2649 2668 N/A INTRINSIC
low complexity region 2674 2702 N/A INTRINSIC
low complexity region 2759 2774 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153077
Meta Mutation Damage Score 0.372 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a single-pass type I membrane protein of unknown function that contains several EGF-like domains, Kelch repeats, and PSI domains. Defects in this gene are a cause of Carpenter syndrome 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for an ENU mutation exhibit varying degrees of heterotaxia and congenital heart defects. Mice homozygous for another ENU-induced mutation exhibit abnormal development and patterning of the peripheral nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T A 8: 86,543,907 probably benign Het
Adrm1 T C 2: 180,174,301 probably null Het
Aldh18a1 T C 19: 40,574,369 I76V probably benign Het
Atp1b2 T C 11: 69,602,879 K125E possibly damaging Het
Cabyr T C 18: 12,750,966 V170A probably damaging Het
Cdh8 T C 8: 99,196,386 T293A probably benign Het
Cenpc1 A T 5: 86,037,617 V345D probably benign Het
Col4a3 A G 1: 82,651,258 E131G unknown Het
Col4a4 C T 1: 82,529,564 probably null Het
Creb3l1 G T 2: 91,995,444 probably null Het
Dhx9 T C 1: 153,465,699 D601G probably benign Het
Dyx1c1 T A 9: 72,972,406 N289K probably benign Het
Eml6 T C 11: 29,809,332 E807G probably damaging Het
Exog C A 9: 119,462,452 T241K probably benign Het
Eya1 T C 1: 14,274,090 D109G probably benign Het
Fam69a G T 5: 107,914,424 D28E probably damaging Het
Fat2 C T 11: 55,252,171 R4284H possibly damaging Het
Fbxw13 C A 9: 109,184,231 G130* probably null Het
Fcrl5 A G 3: 87,446,464 Y372C probably damaging Het
Gli3 T C 13: 15,660,941 S435P probably damaging Het
Gsg1l C T 7: 125,891,680 R284H probably benign Het
Havcr1 C T 11: 46,756,225 T162I probably damaging Het
Igdcc4 T C 9: 65,132,058 F947S probably damaging Het
Irx1 G T 13: 71,963,292 A66E probably damaging Het
Klf11 T C 12: 24,655,491 S315P probably benign Het
Kynu A G 2: 43,602,300 M190V probably benign Het
Lrp2 T C 2: 69,467,135 T3161A probably benign Het
Macrod1 G T 19: 7,196,494 A208S probably damaging Het
Mamdc2 G A 19: 23,310,932 H581Y possibly damaging Het
Mthfd1l G A 10: 4,090,007 R806H probably benign Het
Nags T A 11: 102,145,984 V133D probably damaging Het
Nrg3 C A 14: 38,370,949 D560Y probably damaging Het
Olfr1198 A G 2: 88,746,144 F248S probably damaging Het
Olfr1280 A G 2: 111,316,116 I212M probably benign Het
Olfr1313 C A 2: 112,071,975 G203* probably null Het
Olfr313 T C 11: 58,817,727 S240P probably damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pde6d T C 1: 86,547,526 probably null Het
Plekhf1 T C 7: 38,221,577 E189G probably benign Het
Ppm1b A T 17: 85,013,860 I477L probably benign Het
Rad51ap2 C A 12: 11,456,757 Q227K possibly damaging Het
Rnf125 T C 18: 20,977,730 V15A probably benign Het
Rnps1 C T 17: 24,412,419 probably benign Het
Robo1 A G 16: 73,002,010 I953V possibly damaging Het
Sash1 A T 10: 8,742,422 probably null Het
Smarcc2 T C 10: 128,488,159 probably benign Het
Stx12 T A 4: 132,857,361 E224V probably damaging Het
Sun1 T C 5: 139,235,601 V357A probably benign Het
Synpo2l T C 14: 20,662,180 D350G probably damaging Het
Tex15 A T 8: 33,574,885 N1448Y probably benign Het
Tfpi A G 2: 84,442,883 probably benign Het
Tktl2 T A 8: 66,513,206 M472K possibly damaging Het
Tmem40 T C 6: 115,741,615 D43G possibly damaging Het
Tshz2 T A 2: 169,883,951 C156S probably benign Het
Vmn2r101 T A 17: 19,588,815 probably null Het
Vmn2r85 T C 10: 130,425,212 M419V probably benign Het
Wdr73 G A 7: 80,901,242 probably benign Het
Zc3hc1 C T 6: 30,374,764 probably null Het
Zfhx3 T C 8: 108,956,032 Y3368H unknown Het
Zfp263 G A 16: 3,749,716 E632K probably damaging Het
Zfp266 A G 9: 20,500,944 L111P probably damaging Het
Zfp626 T A 7: 27,818,162 S189R probably benign Het
Zfp772 T C 7: 7,203,700 R331G possibly damaging Het
Zkscan5 G A 5: 145,221,079 C797Y probably damaging Het
Other mutations in Megf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Megf8 APN 7 25343684 missense possibly damaging 0.87
IGL00696:Megf8 APN 7 25342392 missense probably benign
IGL01021:Megf8 APN 7 25338374 missense probably benign 0.39
IGL01290:Megf8 APN 7 25349658 nonsense probably null
IGL01392:Megf8 APN 7 25363749 missense probably benign 0.03
IGL01410:Megf8 APN 7 25359871 missense probably benign 0.01
IGL01634:Megf8 APN 7 25358781 splice site probably benign
IGL01648:Megf8 APN 7 25327572 missense probably damaging 1.00
IGL01930:Megf8 APN 7 25334861 missense probably damaging 1.00
IGL01954:Megf8 APN 7 25349014 missense possibly damaging 0.94
IGL02150:Megf8 APN 7 25346417 splice site probably null
IGL02192:Megf8 APN 7 25353860 missense probably damaging 1.00
IGL02250:Megf8 APN 7 25342575 missense probably benign 0.02
IGL02301:Megf8 APN 7 25337900 missense probably damaging 0.96
IGL02317:Megf8 APN 7 25363788 missense probably damaging 1.00
IGL02324:Megf8 APN 7 25340448 missense probably benign 0.10
IGL02503:Megf8 APN 7 25363563 missense possibly damaging 0.70
IGL02583:Megf8 APN 7 25355793 missense probably benign
IGL02636:Megf8 APN 7 25358432 missense probably damaging 0.99
IGL02704:Megf8 APN 7 25359782 missense probably damaging 0.97
IGL02898:Megf8 APN 7 25346508 missense possibly damaging 0.79
IGL03082:Megf8 APN 7 25330236 missense probably benign
IGL03182:Megf8 APN 7 25347348 missense possibly damaging 0.92
PIT4810001:Megf8 UTSW 7 25342285 missense probably damaging 1.00
R0076:Megf8 UTSW 7 25353958 critical splice donor site probably null
R0217:Megf8 UTSW 7 25364079 missense probably damaging 0.99
R0514:Megf8 UTSW 7 25364303 missense possibly damaging 0.86
R0561:Megf8 UTSW 7 25328832 missense probably benign 0.21
R0563:Megf8 UTSW 7 25342395 missense probably damaging 1.00
R0601:Megf8 UTSW 7 25328540 missense probably benign 0.03
R0879:Megf8 UTSW 7 25338471 missense possibly damaging 0.58
R1323:Megf8 UTSW 7 25360102 splice site probably null
R1323:Megf8 UTSW 7 25360102 splice site probably null
R1430:Megf8 UTSW 7 25364343 missense possibly damaging 0.86
R1445:Megf8 UTSW 7 25342656 missense probably damaging 0.97
R1533:Megf8 UTSW 7 25334855 missense possibly damaging 0.70
R1606:Megf8 UTSW 7 25358695 missense probably damaging 1.00
R1635:Megf8 UTSW 7 25346747 missense possibly damaging 0.77
R1654:Megf8 UTSW 7 25338486 missense possibly damaging 0.56
R1661:Megf8 UTSW 7 25363847 missense probably damaging 1.00
R1880:Megf8 UTSW 7 25334860 missense possibly damaging 0.68
R1962:Megf8 UTSW 7 25363551 missense probably damaging 1.00
R2077:Megf8 UTSW 7 25353738 missense probably benign 0.15
R2127:Megf8 UTSW 7 25364582 missense possibly damaging 0.73
R2129:Megf8 UTSW 7 25330715 missense probably damaging 0.98
R2199:Megf8 UTSW 7 25339614 missense possibly damaging 0.87
R2201:Megf8 UTSW 7 25340745 missense probably damaging 1.00
R2205:Megf8 UTSW 7 25341748 missense probably benign 0.13
R2207:Megf8 UTSW 7 25349797 missense probably damaging 0.97
R2361:Megf8 UTSW 7 25348954 missense possibly damaging 0.94
R2680:Megf8 UTSW 7 25317556 missense probably benign 0.01
R3084:Megf8 UTSW 7 25349019 missense probably damaging 1.00
R3086:Megf8 UTSW 7 25349019 missense probably damaging 1.00
R3433:Megf8 UTSW 7 25360124 missense probably benign 0.00
R3939:Megf8 UTSW 7 25359202 missense probably benign 0.07
R4022:Megf8 UTSW 7 25337775 missense probably damaging 1.00
R4214:Megf8 UTSW 7 25355368 missense probably benign 0.03
R4357:Megf8 UTSW 7 25355749 missense probably benign 0.02
R4521:Megf8 UTSW 7 25342701 missense probably benign 0.19
R4620:Megf8 UTSW 7 25355098 missense possibly damaging 0.92
R4700:Megf8 UTSW 7 25363515 missense probably damaging 1.00
R4916:Megf8 UTSW 7 25339664 missense probably benign 0.24
R4940:Megf8 UTSW 7 25360706 missense probably damaging 1.00
R5048:Megf8 UTSW 7 25331092 missense possibly damaging 0.71
R5258:Megf8 UTSW 7 25348326 missense possibly damaging 0.88
R5271:Megf8 UTSW 7 25341706 missense probably damaging 1.00
R5390:Megf8 UTSW 7 25340289 missense possibly damaging 0.92
R5391:Megf8 UTSW 7 25340289 missense possibly damaging 0.92
R5708:Megf8 UTSW 7 25334597 missense probably benign 0.03
R5752:Megf8 UTSW 7 25355114 missense probably damaging 0.97
R5930:Megf8 UTSW 7 25326441 nonsense probably null
R6037:Megf8 UTSW 7 25364406 missense probably damaging 1.00
R6037:Megf8 UTSW 7 25364406 missense probably damaging 1.00
R6153:Megf8 UTSW 7 25347371 missense possibly damaging 0.93
R6210:Megf8 UTSW 7 25343720 missense possibly damaging 0.90
R6457:Megf8 UTSW 7 25349695 missense probably damaging 0.99
R6659:Megf8 UTSW 7 25358734 missense probably benign 0.38
R6867:Megf8 UTSW 7 25331035 missense probably benign 0.42
R6896:Megf8 UTSW 7 25329932 missense probably benign 0.00
R6899:Megf8 UTSW 7 25360713 missense probably damaging 1.00
R6905:Megf8 UTSW 7 25337932 missense probably benign 0.02
R7099:Megf8 UTSW 7 25346520 missense probably damaging 0.99
R7172:Megf8 UTSW 7 25343667 missense probably damaging 0.99
R7378:Megf8 UTSW 7 25348942 missense probably damaging 1.00
R7427:Megf8 UTSW 7 25338371 missense probably benign 0.44
R7492:Megf8 UTSW 7 25353848 missense probably benign 0.24
Z1088:Megf8 UTSW 7 25339669 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GCGGTTGTTTTCTAGACCCG -3'
(R):5'- AAAGAACTGGCATTCCTCACTG -3'

Sequencing Primer
(F):5'- TGGCCACAGAGCCTTTTG -3'
(R):5'- GGCATTCCTCACTGTTCCTTTAC -3'
Posted On2015-02-05