Incidental Mutation 'R3085:Klf11'
ID265603
Institutional Source Beutler Lab
Gene Symbol Klf11
Ensembl Gene ENSMUSG00000020653
Gene NameKruppel-like factor 11
SynonymsTieg2b, D12Ertd427e, Tieg3, Tieg2
MMRRC Submission 040574-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3085 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location24651274-24662789 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24655491 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 315 (S315P)
Ref Sequence ENSEMBL: ENSMUSP00000020982 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020982] [ENSMUST00000139940] [ENSMUST00000144046] [ENSMUST00000146894]
Predicted Effect probably benign
Transcript: ENSMUST00000020982
AA Change: S315P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020982
Gene: ENSMUSG00000020653
AA Change: S315P

DomainStartEndE-ValueType
low complexity region 267 275 N/A INTRINSIC
low complexity region 356 367 N/A INTRINSIC
ZnF_C2H2 384 408 5.9e-3 SMART
ZnF_C2H2 414 438 9.22e-5 SMART
ZnF_C2H2 444 466 1.38e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139940
Predicted Effect probably benign
Transcript: ENSMUST00000144046
Predicted Effect probably benign
Transcript: ENSMUST00000146894
Meta Mutation Damage Score 0.1112 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor that binds to SP1-like sequences in epsilon- and gamma-globin gene promoters. This binding inhibits cell growth and causes apoptosis. Defects in this gene are a cause of maturity-onset diabetes of the young type 7 (MODY7). Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile, show normal hematopoiesis, growth and development, and display no evidence of increased tumor formation following gamma-irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T A 8: 86,543,907 probably benign Het
Adrm1 T C 2: 180,174,301 probably null Het
Aldh18a1 T C 19: 40,574,369 I76V probably benign Het
Atp1b2 T C 11: 69,602,879 K125E possibly damaging Het
Cabyr T C 18: 12,750,966 V170A probably damaging Het
Cdh8 T C 8: 99,196,386 T293A probably benign Het
Cenpc1 A T 5: 86,037,617 V345D probably benign Het
Col4a3 A G 1: 82,651,258 E131G unknown Het
Col4a4 C T 1: 82,529,564 probably null Het
Creb3l1 G T 2: 91,995,444 probably null Het
Dhx9 T C 1: 153,465,699 D601G probably benign Het
Dyx1c1 T A 9: 72,972,406 N289K probably benign Het
Eml6 T C 11: 29,809,332 E807G probably damaging Het
Exog C A 9: 119,462,452 T241K probably benign Het
Eya1 T C 1: 14,274,090 D109G probably benign Het
Fam69a G T 5: 107,914,424 D28E probably damaging Het
Fat2 C T 11: 55,252,171 R4284H possibly damaging Het
Fbxw13 C A 9: 109,184,231 G130* probably null Het
Fcrl5 A G 3: 87,446,464 Y372C probably damaging Het
Gli3 T C 13: 15,660,941 S435P probably damaging Het
Gsg1l C T 7: 125,891,680 R284H probably benign Het
Havcr1 C T 11: 46,756,225 T162I probably damaging Het
Igdcc4 T C 9: 65,132,058 F947S probably damaging Het
Irx1 G T 13: 71,963,292 A66E probably damaging Het
Kynu A G 2: 43,602,300 M190V probably benign Het
Lrp2 T C 2: 69,467,135 T3161A probably benign Het
Macrod1 G T 19: 7,196,494 A208S probably damaging Het
Mamdc2 G A 19: 23,310,932 H581Y possibly damaging Het
Megf8 T A 7: 25,349,019 Y1706N probably damaging Het
Mthfd1l G A 10: 4,090,007 R806H probably benign Het
Nags T A 11: 102,145,984 V133D probably damaging Het
Nrg3 C A 14: 38,370,949 D560Y probably damaging Het
Olfr1198 A G 2: 88,746,144 F248S probably damaging Het
Olfr1280 A G 2: 111,316,116 I212M probably benign Het
Olfr1313 C A 2: 112,071,975 G203* probably null Het
Olfr313 T C 11: 58,817,727 S240P probably damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pde6d T C 1: 86,547,526 probably null Het
Plekhf1 T C 7: 38,221,577 E189G probably benign Het
Ppm1b A T 17: 85,013,860 I477L probably benign Het
Rad51ap2 C A 12: 11,456,757 Q227K possibly damaging Het
Rnf125 T C 18: 20,977,730 V15A probably benign Het
Rnps1 C T 17: 24,412,419 probably benign Het
Robo1 A G 16: 73,002,010 I953V possibly damaging Het
Sash1 A T 10: 8,742,422 probably null Het
Smarcc2 T C 10: 128,488,159 probably benign Het
Stx12 T A 4: 132,857,361 E224V probably damaging Het
Sun1 T C 5: 139,235,601 V357A probably benign Het
Synpo2l T C 14: 20,662,180 D350G probably damaging Het
Tex15 A T 8: 33,574,885 N1448Y probably benign Het
Tfpi A G 2: 84,442,883 probably benign Het
Tktl2 T A 8: 66,513,206 M472K possibly damaging Het
Tmem40 T C 6: 115,741,615 D43G possibly damaging Het
Tshz2 T A 2: 169,883,951 C156S probably benign Het
Vmn2r101 T A 17: 19,588,815 probably null Het
Vmn2r85 T C 10: 130,425,212 M419V probably benign Het
Wdr73 G A 7: 80,901,242 probably benign Het
Zc3hc1 C T 6: 30,374,764 probably null Het
Zfhx3 T C 8: 108,956,032 Y3368H unknown Het
Zfp263 G A 16: 3,749,716 E632K probably damaging Het
Zfp266 A G 9: 20,500,944 L111P probably damaging Het
Zfp626 T A 7: 27,818,162 S189R probably benign Het
Zfp772 T C 7: 7,203,700 R331G possibly damaging Het
Zkscan5 G A 5: 145,221,079 C797Y probably damaging Het
Other mutations in Klf11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01630:Klf11 APN 12 24660369 missense probably benign 0.01
IGL02202:Klf11 APN 12 24653632 missense probably benign 0.37
IGL02527:Klf11 APN 12 24655323 missense probably benign 0.31
IGL02964:Klf11 APN 12 24655627 missense probably damaging 1.00
R0254:Klf11 UTSW 12 24653583 missense probably damaging 1.00
R0553:Klf11 UTSW 12 24655090 missense probably benign 0.12
R0739:Klf11 UTSW 12 24660248 missense probably damaging 1.00
R1584:Klf11 UTSW 12 24655305 missense probably damaging 1.00
R1592:Klf11 UTSW 12 24653738 missense probably damaging 1.00
R2356:Klf11 UTSW 12 24653583 missense probably damaging 1.00
R4690:Klf11 UTSW 12 24655072 missense probably damaging 0.97
R5023:Klf11 UTSW 12 24655359 missense probably benign 0.00
R5483:Klf11 UTSW 12 24655411 nonsense probably null
R5528:Klf11 UTSW 12 24654930 missense probably benign 0.00
R6148:Klf11 UTSW 12 24651568 critical splice donor site probably null
R6698:Klf11 UTSW 12 24653619 missense probably damaging 1.00
R6799:Klf11 UTSW 12 24655639 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- TGTCAAGGAAAATCACCCCTCTG -3'
(R):5'- GCATCCTGGGAAGTTGCAAAC -3'

Sequencing Primer
(F):5'- AGGAAAATCACCCCTCTGATTTCTG -3'
(R):5'- AGTTCCTCCTTCGGGAAAAG -3'
Posted On2015-02-05