Incidental Mutation 'R3086:Fgfr4'
ID 265646
Institutional Source Beutler Lab
Gene Symbol Fgfr4
Ensembl Gene ENSMUSG00000005320
Gene Name fibroblast growth factor receptor 4
Synonyms Fgfr-4
MMRRC Submission 040575-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3086 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 55300631-55316572 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) G to T at 55315205 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000005452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005452]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000005452
SMART Domains Protein: ENSMUSP00000005452
Gene: ENSMUSG00000005320

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IGc2 45 105 1.39e-11 SMART
IGc2 160 228 3.1e-18 SMART
IGc2 259 337 1.59e-6 SMART
low complexity region 369 387 N/A INTRINSIC
low complexity region 416 446 N/A INTRINSIC
TyrKc 464 740 1.67e-148 SMART
low complexity region 764 795 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor receptor family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. The genomic organization of this gene, compared to members 1-3, encompasses 18 exons rather than 19 or 20. Although alternative splicing has been observed, there is no evidence that the C-terminal half of the IgIII domain of this protein varies between three alternate forms, as indicated for members 1-3. This particular family member preferentially binds acidic fibroblast growth factor and, although its specific function is unknown, it is overexpressed in gynecological tumor samples, suggesting a role in breast and ovarian tumorigenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted mutation are viable, healthy and overtly normal, except for a 10% weight reduction at weaning. Mice doubly homozygous for disruptions of Fgfr3 and Fgfr4 show novel phenotypes not seen in either single mutant, including dwarfismand defective respiratory alveogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310039H08Rik T C 17: 47,083,881 (GRCm39) L48P probably damaging Het
Adgra3 A T 5: 50,170,733 (GRCm39) probably null Het
Alms1 A G 6: 85,655,122 (GRCm39) R3223G probably benign Het
Bltp1 A G 3: 37,065,852 (GRCm39) D3483G possibly damaging Het
Cabyr T C 18: 12,884,023 (GRCm39) V170A probably damaging Het
Ces2b A T 8: 105,559,401 (GRCm39) D89V possibly damaging Het
Dhrs2 G T 14: 55,477,301 (GRCm39) V179L probably benign Het
Dlg5 T C 14: 24,216,258 (GRCm39) T595A probably damaging Het
Dock10 T C 1: 80,510,074 (GRCm39) N1585D possibly damaging Het
Dock4 T C 12: 40,781,862 (GRCm39) I689T probably benign Het
Frk G A 10: 34,483,950 (GRCm39) G437D probably damaging Het
Frzb T G 2: 80,248,858 (GRCm39) I199L possibly damaging Het
Gsg1l C T 7: 125,490,852 (GRCm39) R284H probably benign Het
Helq A G 5: 100,921,858 (GRCm39) L782S probably benign Het
Kif20b T C 19: 34,907,115 (GRCm39) F128S probably damaging Het
Kifc2 T C 15: 76,551,452 (GRCm39) F725L probably benign Het
Lekr1 A G 3: 65,634,581 (GRCm39) noncoding transcript Het
Macf1 T A 4: 123,328,901 (GRCm39) M2490L probably benign Het
Megf8 T A 7: 25,048,444 (GRCm39) Y1706N probably damaging Het
N4bp2 A G 5: 65,948,396 (GRCm39) Y342C probably damaging Het
Nf1 T C 11: 79,437,812 (GRCm39) C2057R probably damaging Het
Or4f60 C A 2: 111,902,320 (GRCm39) G203* probably null Het
Or4k36 A G 2: 111,146,461 (GRCm39) I212M probably benign Het
Or6c88 G A 10: 129,407,276 (GRCm39) G251S probably damaging Het
Orc4 G A 2: 48,827,501 (GRCm39) P31S probably benign Het
Pcdha1 G C 18: 37,064,001 (GRCm39) E222Q possibly damaging Het
Prune2 A T 19: 17,098,777 (GRCm39) D1427V possibly damaging Het
Rnps1 C T 17: 24,631,393 (GRCm39) probably benign Het
Rsph4a G C 10: 33,785,198 (GRCm39) V370L probably damaging Het
Sema5b T A 16: 35,443,093 (GRCm39) S33T probably benign Het
Stk-ps2 A C 1: 46,068,236 (GRCm39) noncoding transcript Het
Tep1 A T 14: 51,064,511 (GRCm39) probably null Het
Tet1 T C 10: 62,715,400 (GRCm39) K132E probably benign Het
Tiam2 A G 17: 3,471,857 (GRCm39) K500E probably damaging Het
Tmem131l G T 3: 83,839,046 (GRCm39) R635S probably benign Het
Tmem68 T C 4: 3,569,594 (GRCm39) E32G possibly damaging Het
Vmn2r101 T A 17: 19,809,077 (GRCm39) probably null Het
Zfp780b A G 7: 27,663,055 (GRCm39) I500T probably damaging Het
Zfyve26 G T 12: 79,312,457 (GRCm39) probably benign Het
Other mutations in Fgfr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Fgfr4 APN 13 55,306,983 (GRCm39) missense probably damaging 0.99
IGL02140:Fgfr4 APN 13 55,308,992 (GRCm39) missense probably benign
IGL02817:Fgfr4 APN 13 55,304,481 (GRCm39) critical splice donor site probably null
interference UTSW 13 55,313,777 (GRCm39) missense probably damaging 1.00
Modest UTSW 13 55,314,064 (GRCm39) missense probably damaging 1.00
offense UTSW 13 55,309,328 (GRCm39) missense possibly damaging 0.81
R0153:Fgfr4 UTSW 13 55,309,198 (GRCm39) splice site probably benign
R0727:Fgfr4 UTSW 13 55,304,041 (GRCm39) splice site probably null
R1646:Fgfr4 UTSW 13 55,313,777 (GRCm39) missense probably damaging 1.00
R1749:Fgfr4 UTSW 13 55,315,605 (GRCm39) splice site probably null
R1993:Fgfr4 UTSW 13 55,313,715 (GRCm39) missense probably damaging 1.00
R2037:Fgfr4 UTSW 13 55,315,702 (GRCm39) missense possibly damaging 0.51
R2152:Fgfr4 UTSW 13 55,314,777 (GRCm39) missense probably damaging 1.00
R2386:Fgfr4 UTSW 13 55,315,714 (GRCm39) missense probably benign 0.36
R3939:Fgfr4 UTSW 13 55,304,307 (GRCm39) missense probably null 0.96
R4255:Fgfr4 UTSW 13 55,314,064 (GRCm39) missense probably damaging 1.00
R4463:Fgfr4 UTSW 13 55,304,280 (GRCm39) missense probably benign 0.02
R4510:Fgfr4 UTSW 13 55,309,328 (GRCm39) missense possibly damaging 0.81
R4511:Fgfr4 UTSW 13 55,309,328 (GRCm39) missense possibly damaging 0.81
R4852:Fgfr4 UTSW 13 55,308,969 (GRCm39) missense possibly damaging 0.68
R4932:Fgfr4 UTSW 13 55,315,983 (GRCm39) missense unknown
R5133:Fgfr4 UTSW 13 55,307,828 (GRCm39) missense probably damaging 1.00
R5146:Fgfr4 UTSW 13 55,313,725 (GRCm39) missense probably damaging 1.00
R5380:Fgfr4 UTSW 13 55,315,230 (GRCm39) missense probably damaging 1.00
R5431:Fgfr4 UTSW 13 55,304,464 (GRCm39) missense probably benign
R5927:Fgfr4 UTSW 13 55,314,700 (GRCm39) missense probably damaging 1.00
R6318:Fgfr4 UTSW 13 55,313,921 (GRCm39) missense probably damaging 1.00
R6792:Fgfr4 UTSW 13 55,304,711 (GRCm39) missense possibly damaging 0.65
R7018:Fgfr4 UTSW 13 55,314,013 (GRCm39) missense probably damaging 0.98
R7290:Fgfr4 UTSW 13 55,309,262 (GRCm39) missense probably benign 0.00
R7343:Fgfr4 UTSW 13 55,306,968 (GRCm39) missense probably damaging 1.00
R7808:Fgfr4 UTSW 13 55,308,969 (GRCm39) missense possibly damaging 0.68
R7891:Fgfr4 UTSW 13 55,306,964 (GRCm39) missense probably benign 0.22
R9028:Fgfr4 UTSW 13 55,306,967 (GRCm39) missense probably damaging 1.00
R9144:Fgfr4 UTSW 13 55,315,837 (GRCm39) critical splice acceptor site probably null
R9257:Fgfr4 UTSW 13 55,315,974 (GRCm39) missense unknown
R9399:Fgfr4 UTSW 13 55,304,293 (GRCm39) missense probably damaging 1.00
R9457:Fgfr4 UTSW 13 55,308,940 (GRCm39) missense probably benign
R9553:Fgfr4 UTSW 13 55,309,228 (GRCm39) missense probably damaging 0.99
R9620:Fgfr4 UTSW 13 55,308,994 (GRCm39) missense possibly damaging 0.68
Z1177:Fgfr4 UTSW 13 55,313,742 (GRCm39) missense probably damaging 1.00
Z1177:Fgfr4 UTSW 13 55,309,520 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGCCTGTCTTCAAGTCG -3'
(R):5'- GTCAAAGTCAGGACCGCAGATG -3'

Sequencing Primer
(F):5'- GTCGTCATCCCCTCTAAAAGG -3'
(R):5'- ATGAGGTCTGACCACTGGG -3'
Posted On 2015-02-05