Incidental Mutation 'R3086:Prune2'
ID265656
Institutional Source Beutler Lab
Gene Symbol Prune2
Ensembl Gene ENSMUSG00000039126
Gene Nameprune homolog 2
SynonymsA230083H22Rik, 6330414G02Rik, A330102H22Rik
MMRRC Submission 040575-MU
Accession Numbers

Genbank: NM_181348

Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R3086 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location16956118-17223932 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 17121413 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 1427 (D1427V)
Ref Sequence ENSEMBL: ENSMUSP00000084977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087689]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087689
AA Change: D1427V

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000084977
Gene: ENSMUSG00000039126
AA Change: D1427V

DomainStartEndE-ValueType
DHHA2 208 351 8.32e-17 SMART
low complexity region 433 445 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 547 553 N/A INTRINSIC
low complexity region 962 975 N/A INTRINSIC
low complexity region 1071 1082 N/A INTRINSIC
low complexity region 1368 1378 N/A INTRINSIC
low complexity region 1533 1545 N/A INTRINSIC
low complexity region 1668 1685 N/A INTRINSIC
low complexity region 1740 1751 N/A INTRINSIC
low complexity region 2162 2175 N/A INTRINSIC
low complexity region 2222 2233 N/A INTRINSIC
low complexity region 2591 2606 N/A INTRINSIC
low complexity region 2731 2744 N/A INTRINSIC
SEC14 2882 3037 2.08e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226052
Meta Mutation Damage Score 0.0548 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the B-cell CLL/lymphoma 2 and adenovirus E1B 19 kDa interacting family, whose members play roles in many cellular processes including apotosis, cell transformation, and synaptic function. Several functions for this protein have been demonstrated including suppression of Ras homolog family member A activity, which results in reduced stress fiber formation and suppression of oncogenic cellular transformation. A high molecular weight isoform of this protein has also been shown to colocalize with Adaptor protein complex 2, beta-Adaptin and endodermal markers, suggesting an involvement in post-endocytic trafficking. In prostate cancer cells, this gene acts as a tumor suppressor and its expression is regulated by prostate cancer antigen 3, a non-protein coding gene on the opposite DNA strand in an intron of this gene. Prostate cancer antigen 3 regulates levels of this gene through formation of a double-stranded RNA that undergoes adenosine deaminase actin on RNA-dependent adenosine-to-inosine RNA editing. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
Allele List at MGI

All alleles(160) : Gene trapped(160)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310039H08Rik T C 17: 46,772,955 L48P probably damaging Het
4932438A13Rik A G 3: 37,011,703 D3483G possibly damaging Het
Adgra3 A T 5: 50,013,391 probably null Het
Alms1 A G 6: 85,678,140 R3223G probably benign Het
Cabyr T C 18: 12,750,966 V170A probably damaging Het
Ces2b A T 8: 104,832,769 D89V possibly damaging Het
Dhrs2 G T 14: 55,239,844 V179L probably benign Het
Dlg5 T C 14: 24,166,190 T595A probably damaging Het
Dock10 T C 1: 80,532,357 N1585D possibly damaging Het
Dock4 T C 12: 40,731,863 I689T probably benign Het
Fgfr4 G T 13: 55,167,392 probably benign Het
Frk G A 10: 34,607,954 G437D probably damaging Het
Frzb T G 2: 80,418,514 I199L possibly damaging Het
Gsg1l C T 7: 125,891,680 R284H probably benign Het
Helq A G 5: 100,773,992 L782S probably benign Het
Kif20b T C 19: 34,929,715 F128S probably damaging Het
Kifc2 T C 15: 76,667,252 F725L probably benign Het
Lekr1 A G 3: 65,727,160 noncoding transcript Het
Macf1 T A 4: 123,435,108 M2490L probably benign Het
Megf8 T A 7: 25,349,019 Y1706N probably damaging Het
N4bp2 A G 5: 65,791,053 Y342C probably damaging Het
Nf1 T C 11: 79,546,986 C2057R probably damaging Het
Olfr1280 A G 2: 111,316,116 I212M probably benign Het
Olfr1313 C A 2: 112,071,975 G203* probably null Het
Olfr794 G A 10: 129,571,407 G251S probably damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pcdha1 G C 18: 36,930,948 E222Q possibly damaging Het
Rnps1 C T 17: 24,412,419 probably benign Het
Rsph4a G C 10: 33,909,202 V370L probably damaging Het
Sema5b T A 16: 35,622,723 S33T probably benign Het
Stk-ps2 A C 1: 46,029,076 noncoding transcript Het
Tep1 A T 14: 50,827,054 probably null Het
Tet1 T C 10: 62,879,621 K132E probably benign Het
Tiam2 A G 17: 3,421,582 K500E probably damaging Het
Tmem131l G T 3: 83,931,739 R635S probably benign Het
Tmem68 T C 4: 3,569,594 E32G possibly damaging Het
Vmn2r101 T A 17: 19,588,815 probably null Het
Zfp780b A G 7: 27,963,630 I500T probably damaging Het
Zfyve26 G T 12: 79,265,683 probably benign Het
Other mutations in Prune2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Prune2 APN 19 17168344 critical splice donor site probably null
IGL00848:Prune2 APN 19 17119118 missense probably damaging 1.00
IGL00862:Prune2 APN 19 17119349 missense probably benign 0.41
IGL00915:Prune2 APN 19 17016253 missense probably damaging 1.00
IGL01084:Prune2 APN 19 17118209 missense probably benign 0.19
IGL01109:Prune2 APN 19 17123879 missense probably benign 0.03
IGL01372:Prune2 APN 19 17125069 missense probably damaging 1.00
IGL01650:Prune2 APN 19 17168292 missense possibly damaging 0.95
IGL01752:Prune2 APN 19 17123903 missense possibly damaging 0.50
IGL01812:Prune2 APN 19 17003777 missense possibly damaging 0.50
IGL01902:Prune2 APN 19 17118638 missense probably benign 0.00
IGL02195:Prune2 APN 19 17119557 missense probably benign 0.00
IGL02502:Prune2 APN 19 17123881 missense probably benign 0.00
IGL02569:Prune2 APN 19 17178859 missense probably damaging 0.99
IGL02693:Prune2 APN 19 17124491 missense probably benign 0.03
IGL02737:Prune2 APN 19 17193411 nonsense probably null
IGL02794:Prune2 APN 19 17119361 missense probably benign 0.19
IGL02985:Prune2 APN 19 17016359 critical splice donor site probably null
IGL03349:Prune2 APN 19 17123346 missense probably damaging 1.00
3-1:Prune2 UTSW 19 17125282 missense probably benign 0.00
R0060:Prune2 UTSW 19 17003733 missense probably damaging 1.00
R0098:Prune2 UTSW 19 17123903 missense possibly damaging 0.50
R0098:Prune2 UTSW 19 17123903 missense possibly damaging 0.50
R0165:Prune2 UTSW 19 17122610 missense probably benign 0.00
R0277:Prune2 UTSW 19 17121389 missense probably damaging 0.99
R0321:Prune2 UTSW 19 17120927 missense possibly damaging 0.78
R0321:Prune2 UTSW 19 17122454 missense probably benign 0.39
R0374:Prune2 UTSW 19 17120910 missense probably benign 0.00
R0380:Prune2 UTSW 19 17124007 missense probably damaging 1.00
R0396:Prune2 UTSW 19 17123080 missense probably benign 0.35
R0408:Prune2 UTSW 19 17122310 missense probably benign 0.00
R0421:Prune2 UTSW 19 17123311 missense probably benign 0.02
R0480:Prune2 UTSW 19 17006792 splice site probably benign
R0531:Prune2 UTSW 19 17006753 missense probably damaging 1.00
R0546:Prune2 UTSW 19 17020666 splice site probably benign
R0554:Prune2 UTSW 19 17125218 nonsense probably null
R0659:Prune2 UTSW 19 17122835 missense probably damaging 1.00
R0699:Prune2 UTSW 19 17123955 missense probably damaging 1.00
R0781:Prune2 UTSW 19 17125222 missense probably benign
R1110:Prune2 UTSW 19 17125222 missense probably benign
R1178:Prune2 UTSW 19 17123105 missense probably benign 0.22
R1181:Prune2 UTSW 19 17123105 missense probably benign 0.22
R1337:Prune2 UTSW 19 17119607 missense possibly damaging 0.70
R1356:Prune2 UTSW 19 17212317 missense probably benign 0.40
R1385:Prune2 UTSW 19 17124948 missense possibly damaging 0.50
R1659:Prune2 UTSW 19 17120651 missense possibly damaging 0.59
R1738:Prune2 UTSW 19 17125010 missense probably benign 0.01
R1756:Prune2 UTSW 19 17123704 missense probably benign 0.01
R1765:Prune2 UTSW 19 17125598 missense probably damaging 1.00
R1782:Prune2 UTSW 19 17122173 missense probably benign 0.00
R1817:Prune2 UTSW 19 17122081 missense probably benign 0.00
R1838:Prune2 UTSW 19 17199878 missense probably damaging 1.00
R1851:Prune2 UTSW 19 17199139 missense probably damaging 1.00
R1852:Prune2 UTSW 19 17199139 missense probably damaging 1.00
R1866:Prune2 UTSW 19 17123492 missense probably damaging 1.00
R1911:Prune2 UTSW 19 17113674 missense probably benign 0.02
R1983:Prune2 UTSW 19 17020642 missense probably damaging 0.97
R2014:Prune2 UTSW 19 17120523 missense probably damaging 1.00
R2066:Prune2 UTSW 19 17120678 missense possibly damaging 0.57
R2088:Prune2 UTSW 19 17119745 missense possibly damaging 0.95
R2111:Prune2 UTSW 19 17208238 missense probably damaging 1.00
R2128:Prune2 UTSW 19 17122422 missense probably benign 0.00
R2165:Prune2 UTSW 19 17120182 missense probably benign 0.19
R2241:Prune2 UTSW 19 17123092 missense probably damaging 0.96
R2278:Prune2 UTSW 19 17118555 missense possibly damaging 0.93
R2504:Prune2 UTSW 19 17000036 missense probably damaging 1.00
R2508:Prune2 UTSW 19 17122622 missense probably benign 0.43
R3055:Prune2 UTSW 19 17125043 missense probably damaging 0.98
R3104:Prune2 UTSW 19 17119156 missense probably damaging 1.00
R3105:Prune2 UTSW 19 17119156 missense probably damaging 1.00
R3547:Prune2 UTSW 19 17124348 missense probably damaging 0.96
R3702:Prune2 UTSW 19 17178871 missense probably damaging 1.00
R3753:Prune2 UTSW 19 17125454 missense probably benign 0.38
R3933:Prune2 UTSW 19 17123954 missense probably damaging 1.00
R3935:Prune2 UTSW 19 17199786 missense probably damaging 1.00
R4022:Prune2 UTSW 19 17000020 missense probably damaging 1.00
R4042:Prune2 UTSW 19 17003826 critical splice donor site probably null
R4164:Prune2 UTSW 19 17003734 missense possibly damaging 0.87
R4453:Prune2 UTSW 19 17121910 missense probably benign 0.00
R4642:Prune2 UTSW 19 17020655 critical splice donor site probably null
R4661:Prune2 UTSW 19 17000023 missense probably damaging 1.00
R4666:Prune2 UTSW 19 17120188 nonsense probably null
R4823:Prune2 UTSW 19 17120504 missense probably damaging 1.00
R4897:Prune2 UTSW 19 17121855 missense probably benign 0.03
R4922:Prune2 UTSW 19 17122752 missense probably benign 0.00
R4962:Prune2 UTSW 19 17122273 missense probably benign 0.11
R5026:Prune2 UTSW 19 17199142 missense probably damaging 1.00
R5042:Prune2 UTSW 19 17119797 missense possibly damaging 0.94
R5124:Prune2 UTSW 19 17199910 missense probably damaging 1.00
R5133:Prune2 UTSW 19 17003631 missense probably damaging 1.00
R5184:Prune2 UTSW 19 17216357 missense possibly damaging 0.95
R5234:Prune2 UTSW 19 17118668 missense probably damaging 1.00
R5339:Prune2 UTSW 19 17120872 missense probably damaging 1.00
R5363:Prune2 UTSW 19 17118266 missense probably damaging 1.00
R5382:Prune2 UTSW 19 17003659 missense probably damaging 1.00
R5436:Prune2 UTSW 19 17020643 missense probably damaging 1.00
R5480:Prune2 UTSW 19 17120947 missense possibly damaging 0.66
R5635:Prune2 UTSW 19 17118209 missense probably benign 0.19
R5678:Prune2 UTSW 19 17118668 missense probably damaging 1.00
R5814:Prune2 UTSW 19 17016361 splice site probably null
R5894:Prune2 UTSW 19 17121391 missense possibly damaging 0.88
R6011:Prune2 UTSW 19 17118716 missense probably benign 0.35
R6207:Prune2 UTSW 19 17118116 missense probably damaging 1.00
R6218:Prune2 UTSW 19 17121562 missense probably benign 0.00
R6573:Prune2 UTSW 19 17121157 missense probably damaging 1.00
R6573:Prune2 UTSW 19 17121158 missense possibly damaging 0.61
R6734:Prune2 UTSW 19 17003733 missense probably damaging 1.00
R6805:Prune2 UTSW 19 17120590 missense probably benign
R6837:Prune2 UTSW 19 17178928 missense probably damaging 1.00
R6850:Prune2 UTSW 19 17122188 missense probably benign 0.00
R6858:Prune2 UTSW 19 17118106 missense possibly damaging 0.70
R6874:Prune2 UTSW 19 17123228 missense probably damaging 1.00
R6954:Prune2 UTSW 19 17000021 missense probably damaging 1.00
R7098:Prune2 UTSW 19 17120602 missense not run
R7102:Prune2 UTSW 19 17121213 missense not run
X0019:Prune2 UTSW 19 17121517 missense probably benign 0.16
X0028:Prune2 UTSW 19 17122885 missense probably damaging 1.00
X0064:Prune2 UTSW 19 17122375 missense probably damaging 1.00
X0066:Prune2 UTSW 19 17118790 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTCTTCAGATGCATTTGAACACC -3'
(R):5'- TCACTATCCATCGGGCCATC -3'

Sequencing Primer
(F):5'- GACATCTCCAGTGCATCAGG -3'
(R):5'- TCCCAAACACCAAAGTCTTGAGAAG -3'
Posted On2015-02-05