Incidental Mutation 'R3022:Or10aa1'
ID 265726
Institutional Source Beutler Lab
Gene Symbol Or10aa1
Ensembl Gene ENSMUSG00000045381
Gene Name olfactory receptor family 10 subfamily AA member 1
Synonyms GA_x6K02T2P20D-21133014-21132070, Olfr433, MOR123-1
MMRRC Submission 040538-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.060) question?
Stock # R3022 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 173869499-173870502 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 173869650 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 45 (I45V)
Ref Sequence ENSEMBL: ENSMUSP00000149005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052975] [ENSMUST00000214690]
AlphaFold Q7TRV9
Predicted Effect probably benign
Transcript: ENSMUST00000052975
AA Change: I45V

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000056772
Gene: ENSMUSG00000045381
AA Change: I45V

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 4.6e-51 PFAM
Pfam:7TM_GPCR_Srsx 35 170 2.9e-8 PFAM
Pfam:7tm_1 41 289 1.3e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214690
AA Change: I45V

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 11 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bptf T A 11: 107,002,463 (GRCm39) probably null Het
Dnah3 T A 7: 119,677,704 (GRCm39) I406F possibly damaging Het
Dnah7b G A 1: 46,221,583 (GRCm39) C1229Y probably damaging Het
Flywch1 T C 17: 23,982,082 (GRCm39) R41G probably benign Het
Itpkb A T 1: 180,245,888 (GRCm39) T802S probably damaging Het
Kdm1b C T 13: 47,216,553 (GRCm39) R308W probably damaging Het
Padi2 T A 4: 140,665,299 (GRCm39) V468E possibly damaging Het
Prom1 G A 5: 44,204,916 (GRCm39) T177I probably damaging Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Stx5a T C 19: 8,732,518 (GRCm39) probably benign Het
Vmn1r237 T A 17: 21,534,709 (GRCm39) I144K probably damaging Het
Other mutations in Or10aa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01760:Or10aa1 APN 1 173,870,191 (GRCm39) missense probably damaging 0.99
IGL02369:Or10aa1 APN 1 173,869,539 (GRCm39) missense possibly damaging 0.64
IGL03256:Or10aa1 APN 1 173,869,774 (GRCm39) missense probably damaging 1.00
IGL03297:Or10aa1 APN 1 173,869,683 (GRCm39) missense probably benign 0.00
R0837:Or10aa1 UTSW 1 173,870,053 (GRCm39) missense probably damaging 1.00
R1583:Or10aa1 UTSW 1 173,870,046 (GRCm39) missense probably benign 0.11
R1974:Or10aa1 UTSW 1 173,870,154 (GRCm39) missense probably damaging 1.00
R2280:Or10aa1 UTSW 1 173,870,087 (GRCm39) missense probably benign 0.00
R2897:Or10aa1 UTSW 1 173,869,699 (GRCm39) missense probably damaging 1.00
R4478:Or10aa1 UTSW 1 173,870,182 (GRCm39) missense probably benign 0.00
R6364:Or10aa1 UTSW 1 173,869,778 (GRCm39) missense possibly damaging 0.80
R6588:Or10aa1 UTSW 1 173,869,844 (GRCm39) missense probably benign 0.01
R7343:Or10aa1 UTSW 1 173,870,419 (GRCm39) missense probably damaging 0.98
R7409:Or10aa1 UTSW 1 173,870,099 (GRCm39) missense probably benign 0.02
R7714:Or10aa1 UTSW 1 173,869,900 (GRCm39) missense probably benign 0.00
R7788:Or10aa1 UTSW 1 173,869,650 (GRCm39) missense probably benign 0.13
R8982:Or10aa1 UTSW 1 173,870,188 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGTTGCTGCTCTTGACTCTAG -3'
(R):5'- ATACAGCTGGACGAAGCATGC -3'

Sequencing Primer
(F):5'- GGAAGATCCTGACGTAGTTAATCTTG -3'
(R):5'- CTGGACGAAGCATGCAGACG -3'
Posted On 2015-02-05