Incidental Mutation 'R3025:Olfr228'
ID265790
Institutional Source Beutler Lab
Gene Symbol Olfr228
Ensembl Gene ENSMUSG00000111772
Gene Name
SynonymsMOR189-3, GA_x6K02T0101M-139-669
MMRRC Submission 040541-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R3025 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location86481921-86487386 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 86483739 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000149449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000216534] [ENSMUST00000217292]
Predicted Effect probably null
Transcript: ENSMUST00000099883
AA Change: M1K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097468
Gene: ENSMUSG00000075180
AA Change: M1K

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 1.5e-54 PFAM
Pfam:7tm_1 41 290 5.6e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215705
Predicted Effect probably null
Transcript: ENSMUST00000216534
AA Change: M1K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably null
Transcript: ENSMUST00000217292
AA Change: M1K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace T A 11: 105,974,093 probably null Het
Akap6 A G 12: 53,140,143 T1447A probably benign Het
Atp13a2 C T 4: 140,994,348 R250C probably damaging Het
Cacna1a T A 8: 84,580,225 probably null Het
Chd6 GATCAT GAT 2: 160,966,552 probably benign Het
Cptp T C 4: 155,867,221 E5G possibly damaging Het
Dnajc16 C A 4: 141,774,611 V303F probably benign Het
Gm10842 T C 11: 105,147,076 S62P unknown Het
Gm17509 T C 13: 117,220,576 probably benign Het
Homer1 C T 13: 93,402,074 Q142* probably null Het
Kcnb2 C A 1: 15,710,835 Q644K possibly damaging Het
Map3k19 T C 1: 127,838,553 probably null Het
Msh4 T A 3: 153,863,491 H621L probably damaging Het
Ogfod1 A T 8: 94,063,052 E460D probably damaging Het
Olfr808 T A 10: 129,767,673 F59Y probably damaging Het
Rp1 G A 1: 4,352,675 R61W probably damaging Het
Scaf4 A T 16: 90,251,938 H329Q unknown Het
Sec61a1 A T 6: 88,512,220 D166E probably damaging Het
Tars2 C T 3: 95,747,640 R63H possibly damaging Het
Vmn1r57 A T 7: 5,220,715 K80* probably null Het
Vmn2r106 A G 17: 20,278,885 W255R probably benign Het
Wdr49 C G 3: 75,333,356 C402S possibly damaging Het
Other mutations in Olfr228
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Olfr228 APN 2 86483218 missense probably benign 0.05
IGL02136:Olfr228 APN 2 86483465 missense probably damaging 1.00
IGL02419:Olfr228 APN 2 86482915 missense probably damaging 0.99
IGL03008:Olfr228 APN 2 86483334 missense probably damaging 1.00
R0240:Olfr228 UTSW 2 86483386 missense possibly damaging 0.78
R0240:Olfr228 UTSW 2 86483386 missense possibly damaging 0.78
R1073:Olfr228 UTSW 2 86483640 missense probably damaging 0.98
R1163:Olfr228 UTSW 2 86483238 missense probably damaging 1.00
R1505:Olfr228 UTSW 2 86483213 missense possibly damaging 0.94
R1806:Olfr228 UTSW 2 86483139 missense probably damaging 0.99
R1940:Olfr228 UTSW 2 86483359 nonsense probably null
R3037:Olfr228 UTSW 2 86483643 missense probably damaging 0.96
R5156:Olfr228 UTSW 2 86483018 nonsense probably null
R6459:Olfr228 UTSW 2 86483229 missense probably benign 0.23
R6472:Olfr228 UTSW 2 86483190 nonsense probably null
R6493:Olfr228 UTSW 2 86483221 missense possibly damaging 0.59
R6880:Olfr228 UTSW 2 86483725 missense probably benign
X0028:Olfr228 UTSW 2 86482890 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTTTGTAGCCTGGAATCCACC -3'
(R):5'- GACTGGATGACTTCTTGCCTAG -3'

Sequencing Primer
(F):5'- TCCACCATGGTAAGGATGATCATGC -3'
(R):5'- TGGATGACTTCTTGCCTAGATATTAG -3'
Posted On2015-02-05