Mutagenetix > Incidental Mutation

Incidental Mutation 'R3025:Atp13a2'

265794

Institutional Source

Beutler Lab

Gene Symbol

Atp13a2

Ensembl Gene

ENSMUSG00000036622

Gene Name

ATPase type 13A2

Synonyms

1110012E06Rik

MMRRC Submission

040541-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3025 (G1)

Quality Score

180

Status

Not validated

Chromosome

Chromosomal Location

140714184-140734641 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 140721659 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 250 (R250C)

Ref Sequence

ENSEMBL: ENSMUSP00000126461 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037055] [ENSMUST00000127833] [ENSMUST00000168047]

AlphaFold

Q9CTG6

Predicted Effect

probably damaging
Transcript: ENSMUST00000037055
AA Change: R167C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000039648
Gene: ENSMUSG00000036622
AA Change: R167C

Domain	Start	End	E-Value	Type
Pfam:P5-ATPase	31	171	8.9e-27	PFAM
Cation_ATPase_N	179	251	9.78e-1	SMART
Pfam:E1-E2_ATPase	256	497	3.6e-39	PFAM
Pfam:Hydrolase	502	785	2e-14	PFAM
Pfam:HAD	505	876	3.6e-27	PFAM
transmembrane domain	920	942	N/A	INTRINSIC
transmembrane domain	957	979	N/A	INTRINSIC
transmembrane domain	991	1013	N/A	INTRINSIC
transmembrane domain	1033	1055	N/A	INTRINSIC
transmembrane domain	1068	1090	N/A	INTRINSIC
transmembrane domain	1105	1127	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125797

Predicted Effect

probably damaging
Transcript: ENSMUST00000127833
AA Change: R167C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000132183
Gene: ENSMUSG00000036622
AA Change: R167C

Domain	Start	End	E-Value	Type
Pfam:P5-ATPase	31	164	7.4e-29	PFAM
Cation_ATPase_N	179	251	9.78e-1	SMART
Pfam:E1-E2_ATPase	256	496	6e-34	PFAM
Pfam:HAD	505	876	4e-27	PFAM
Pfam:Hydrolase	663	879	2.5e-15	PFAM
transmembrane domain	925	947	N/A	INTRINSIC
transmembrane domain	954	976	N/A	INTRINSIC
transmembrane domain	991	1013	N/A	INTRINSIC
low complexity region	1102	1115	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135117

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151517

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156995

Predicted Effect

probably damaging
Transcript: ENSMUST00000168047
AA Change: R250C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126461
Gene: ENSMUSG00000036622
AA Change: R250C

Domain	Start	End	E-Value	Type
Pfam:P5-ATPase	31	156	1e-27	PFAM
Cation_ATPase_N	262	334	9.78e-1	SMART
Pfam:E1-E2_ATPase	339	579	4.8e-34	PFAM
Pfam:HAD	588	959	3e-27	PFAM
Pfam:Hydrolase	726	962	1.8e-15	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the P5 subfamily of ATPases which transports inorganic cations as well as other substrates. Mutations in this gene are associated with Kufor-Rakeb syndrome (KRS), also referred to as Parkinson disease 9. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neuronal ceroid lipofuscinosis, synuclein accumulation and age-dependent sensorimotor deficits. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 22 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ace	T	A	11: 105,864,919 (GRCm39)		probably null	Het
Akap6	A	G	12: 53,186,926 (GRCm39)	T1447A	probably benign	Het
Cacna1a	T	A	8: 85,306,854 (GRCm39)		probably null	Het
Chd6	GATCAT	GAT	2: 160,808,472 (GRCm39)		probably benign	Het
Cptp	T	C	4: 155,951,678 (GRCm39)	E5G	possibly damaging	Het
Dnajc16	C	A	4: 141,501,922 (GRCm39)	V303F	probably benign	Het
Gm10842	T	C	11: 105,037,902 (GRCm39)	S62P	unknown	Het
Gm17509	T	C	13: 117,357,112 (GRCm39)		probably benign	Het
Homer1	C	T	13: 93,538,582 (GRCm39)	Q142*	probably null	Het
Kcnb2	C	A	1: 15,781,059 (GRCm39)	Q644K	possibly damaging	Het
Map3k19	T	C	1: 127,766,290 (GRCm39)		probably null	Het
Msh4	T	A	3: 153,569,128 (GRCm39)	H621L	probably damaging	Het
Ogfod1	A	T	8: 94,789,680 (GRCm39)	E460D	probably damaging	Het
Or6c65	T	A	10: 129,603,542 (GRCm39)	F59Y	probably damaging	Het
Or8k41	A	T	2: 86,314,083 (GRCm39)	M1K	probably null	Het
Rp1	G	A	1: 4,422,898 (GRCm39)	R61W	probably damaging	Het
Scaf4	A	T	16: 90,048,826 (GRCm39)	H329Q	unknown	Het
Sec61a1	A	T	6: 88,489,202 (GRCm39)	D166E	probably damaging	Het
Tars2	C	T	3: 95,654,952 (GRCm39)	R63H	possibly damaging	Het
Vmn1r57	A	T	7: 5,223,714 (GRCm39)	K80*	probably null	Het
Vmn2r106	A	G	17: 20,499,147 (GRCm39)	W255R	probably benign	Het
Wdr49	C	G	3: 75,240,663 (GRCm39)	C402S	possibly damaging	Het

Other mutations in Atp13a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01410:Atp13a2	APN	4	140,719,509 (GRCm39)	missense	probably benign	0.02
IGL01476:Atp13a2	APN	4	140,728,081 (GRCm39)	missense	probably damaging	1.00
IGL01980:Atp13a2	APN	4	140,733,463 (GRCm39)	missense	probably benign	0.00
IGL02257:Atp13a2	APN	4	140,733,400 (GRCm39)	missense	probably benign	0.00
IGL02589:Atp13a2	APN	4	140,733,722 (GRCm39)	missense	probably damaging	1.00
IGL02936:Atp13a2	APN	4	140,729,260 (GRCm39)	missense	probably benign	0.00
IGL03032:Atp13a2	APN	4	140,727,666 (GRCm39)	missense	possibly damaging	0.95
IGL03040:Atp13a2	APN	4	140,733,484 (GRCm39)	missense	probably damaging	1.00
IGL03271:Atp13a2	APN	4	140,727,708 (GRCm39)	missense	possibly damaging	0.69
calla	UTSW	4	140,721,643 (GRCm39)	nonsense	probably null
eastern_moon	UTSW	4	140,732,327 (GRCm39)	missense	probably damaging	0.99
yucca_brevifolia	UTSW	4	140,721,113 (GRCm39)	missense	probably damaging	1.00
IGL03054:Atp13a2	UTSW	4	140,734,279 (GRCm39)	missense	possibly damaging	0.83
PIT4469001:Atp13a2	UTSW	4	140,721,438 (GRCm39)	missense	unknown
R0634:Atp13a2	UTSW	4	140,734,240 (GRCm39)	unclassified	probably benign
R0881:Atp13a2	UTSW	4	140,731,242 (GRCm39)	missense	probably damaging	1.00
R1295:Atp13a2	UTSW	4	140,721,113 (GRCm39)	missense	probably damaging	1.00
R1296:Atp13a2	UTSW	4	140,721,113 (GRCm39)	missense	probably damaging	1.00
R1472:Atp13a2	UTSW	4	140,721,113 (GRCm39)	missense	probably damaging	1.00
R1780:Atp13a2	UTSW	4	140,729,771 (GRCm39)	missense	possibly damaging	0.73
R1837:Atp13a2	UTSW	4	140,721,643 (GRCm39)	nonsense	probably null
R1838:Atp13a2	UTSW	4	140,721,643 (GRCm39)	nonsense	probably null
R1856:Atp13a2	UTSW	4	140,731,323 (GRCm39)	missense	probably benign	0.43
R1918:Atp13a2	UTSW	4	140,723,682 (GRCm39)	missense	possibly damaging	0.90
R1956:Atp13a2	UTSW	4	140,731,572 (GRCm39)	missense	possibly damaging	0.92
R2126:Atp13a2	UTSW	4	140,722,702 (GRCm39)	missense	possibly damaging	0.94
R2130:Atp13a2	UTSW	4	140,732,327 (GRCm39)	missense	probably damaging	0.99
R2132:Atp13a2	UTSW	4	140,732,327 (GRCm39)	missense	probably damaging	0.99
R2133:Atp13a2	UTSW	4	140,732,327 (GRCm39)	missense	probably damaging	0.99
R2397:Atp13a2	UTSW	4	140,730,466 (GRCm39)	missense	probably benign	0.00
R2873:Atp13a2	UTSW	4	140,730,294 (GRCm39)	missense	probably benign	0.00
R3939:Atp13a2	UTSW	4	140,733,733 (GRCm39)	missense	probably damaging	0.98
R3940:Atp13a2	UTSW	4	140,733,733 (GRCm39)	missense	probably damaging	0.98
R3942:Atp13a2	UTSW	4	140,733,733 (GRCm39)	missense	probably damaging	0.98
R4247:Atp13a2	UTSW	4	140,719,539 (GRCm39)	critical splice donor site	probably null
R4357:Atp13a2	UTSW	4	140,729,215 (GRCm39)	missense	probably benign	0.01
R4406:Atp13a2	UTSW	4	140,733,787 (GRCm39)	missense	probably damaging	1.00
R4686:Atp13a2	UTSW	4	140,730,587 (GRCm39)	critical splice donor site	probably null
R5033:Atp13a2	UTSW	4	140,728,132 (GRCm39)	missense	possibly damaging	0.91
R5066:Atp13a2	UTSW	4	140,732,449 (GRCm39)	missense	probably damaging	1.00
R5278:Atp13a2	UTSW	4	140,728,129 (GRCm39)	missense	probably damaging	0.97
R5464:Atp13a2	UTSW	4	140,733,381 (GRCm39)	missense	probably damaging	1.00
R5522:Atp13a2	UTSW	4	140,731,671 (GRCm39)	splice site	probably null
R5614:Atp13a2	UTSW	4	140,719,493 (GRCm39)	missense	probably benign	0.35
R5846:Atp13a2	UTSW	4	140,722,907 (GRCm39)	missense	possibly damaging	0.81
R6378:Atp13a2	UTSW	4	140,734,367 (GRCm39)	missense	probably benign	0.34
R6512:Atp13a2	UTSW	4	140,730,529 (GRCm39)	missense	probably damaging	1.00
R6518:Atp13a2	UTSW	4	140,728,165 (GRCm39)	missense	possibly damaging	0.89
R6519:Atp13a2	UTSW	4	140,728,165 (GRCm39)	missense	possibly damaging	0.89
R7166:Atp13a2	UTSW	4	140,734,295 (GRCm39)	missense	possibly damaging	0.89
R7178:Atp13a2	UTSW	4	140,726,462 (GRCm39)	missense	probably damaging	1.00
R7657:Atp13a2	UTSW	4	140,719,815 (GRCm39)	missense	possibly damaging	0.92
R8256:Atp13a2	UTSW	4	140,722,922 (GRCm39)	missense	possibly damaging	0.94
R8313:Atp13a2	UTSW	4	140,730,046 (GRCm39)	missense	probably benign
R8318:Atp13a2	UTSW	4	140,734,335 (GRCm39)	missense	probably benign	0.14
R8781:Atp13a2	UTSW	4	140,723,691 (GRCm39)	missense	probably benign	0.36
R9142:Atp13a2	UTSW	4	140,729,364 (GRCm39)	missense	probably damaging	1.00
R9145:Atp13a2	UTSW	4	140,724,056 (GRCm39)	missense	probably damaging	0.99
R9158:Atp13a2	UTSW	4	140,724,112 (GRCm39)	critical splice donor site	probably null
R9256:Atp13a2	UTSW	4	140,730,038 (GRCm39)	missense	probably damaging	0.98
R9339:Atp13a2	UTSW	4	140,730,571 (GRCm39)	missense	probably benign	0.00
Z1176:Atp13a2	UTSW	4	140,732,428 (GRCm39)	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CGAAGGCCTGTGATACTATCTG -3'
(R):5'- ACCCTATGAGGTGAGACGTACC -3'

Sequencing Primer
(F):5'- CTGTGATACTATCTGACCGGCAAG -3'
(R):5'- TGAGACGTACCCTCACCC -3'

Posted On

2015-02-05