Incidental Mutation 'R3025:Sec61a1'
ID265797
Institutional Source Beutler Lab
Gene Symbol Sec61a1
Ensembl Gene ENSMUSG00000030082
Gene NameSec61 alpha 1 subunit (S. cerevisiae)
SynonymsSec61a
MMRRC Submission 040541-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.902) question?
Stock #R3025 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location88503579-88518905 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88512220 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 166 (D166E)
Ref Sequence ENSEMBL: ENSMUSP00000032168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032168]
Predicted Effect probably damaging
Transcript: ENSMUST00000032168
AA Change: D166E

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000032168
Gene: ENSMUSG00000030082
AA Change: D166E

DomainStartEndE-ValueType
Pfam:Plug_translocon 40 74 6.2e-21 PFAM
Pfam:SecY 75 458 3.1e-79 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130807
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130918
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139551
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139676
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145421
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203200
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203943
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204502
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the SECY/SEC61- alpha family. It appears to play a crucial role in the insertion of secretory and membrane polypeptides into the endoplasmic reticulum. This protein found to be tightly associated with membrane-bound ribosomes, either directly or through adaptor proteins. This gene encodes an alpha subunit of the heteromeric SEC61 complex, which also contains beta and gamma subunits. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit decreased body weight, hyperglycemia, hypoinsulinemia, impaired glucose tolerance, apoptosis of beta-cells, and enlarged and pale liver with hepatic steatosis and cirrhosis when fed a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace T A 11: 105,974,093 probably null Het
Akap6 A G 12: 53,140,143 T1447A probably benign Het
Atp13a2 C T 4: 140,994,348 R250C probably damaging Het
Cacna1a T A 8: 84,580,225 probably null Het
Chd6 GATCAT GAT 2: 160,966,552 probably benign Het
Cptp T C 4: 155,867,221 E5G possibly damaging Het
Dnajc16 C A 4: 141,774,611 V303F probably benign Het
Gm10842 T C 11: 105,147,076 S62P unknown Het
Gm17509 T C 13: 117,220,576 probably benign Het
Homer1 C T 13: 93,402,074 Q142* probably null Het
Kcnb2 C A 1: 15,710,835 Q644K possibly damaging Het
Map3k19 T C 1: 127,838,553 probably null Het
Msh4 T A 3: 153,863,491 H621L probably damaging Het
Ogfod1 A T 8: 94,063,052 E460D probably damaging Het
Olfr228 A T 2: 86,483,739 M1K probably null Het
Olfr808 T A 10: 129,767,673 F59Y probably damaging Het
Rp1 G A 1: 4,352,675 R61W probably damaging Het
Scaf4 A T 16: 90,251,938 H329Q unknown Het
Tars2 C T 3: 95,747,640 R63H possibly damaging Het
Vmn1r57 A T 7: 5,220,715 K80* probably null Het
Vmn2r106 A G 17: 20,278,885 W255R probably benign Het
Wdr49 C G 3: 75,333,356 C402S possibly damaging Het
Other mutations in Sec61a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Sec61a1 APN 6 88506940 splice site probably benign
IGL01481:Sec61a1 APN 6 88506847 missense probably benign
R4230:Sec61a1 UTSW 6 88515431 splice site probably null
R4598:Sec61a1 UTSW 6 88506149 missense probably benign
R6232:Sec61a1 UTSW 6 88505168 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- TGGATGCACAGCAAAACCAG -3'
(R):5'- TGCCCTTGTTAAGAGCAGATG -3'

Sequencing Primer
(F):5'- AAAACCAGGAGCTTGTGCCTTTG -3'
(R):5'- CCCTTGTTAAGAGCAGATGAAGGC -3'
Posted On2015-02-05