Incidental Mutation 'R3025:Olfr808'
ID265802
Institutional Source Beutler Lab
Gene Symbol Olfr808
Ensembl Gene ENSMUSG00000049894
Gene Nameolfactory receptor 808
SynonymsGA_x6K02T2PULF-11446184-11447122, MOR112-2
MMRRC Submission 040541-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R3025 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location129765482-129771713 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 129767673 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 59 (F59Y)
Ref Sequence ENSEMBL: ENSMUSP00000145315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060636] [ENSMUST00000203236]
Predicted Effect probably damaging
Transcript: ENSMUST00000060636
AA Change: F59Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000059714
Gene: ENSMUSG00000049894
AA Change: F59Y

DomainStartEndE-ValueType
Pfam:7tm_4 29 308 1.8e-53 PFAM
Pfam:7tm_1 39 288 7.7e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203236
AA Change: F59Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000145315
Gene: ENSMUSG00000049894
AA Change: F59Y

DomainStartEndE-ValueType
Pfam:7tm_4 29 308 1.8e-53 PFAM
Pfam:7tm_1 39 288 7.7e-25 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace T A 11: 105,974,093 probably null Het
Akap6 A G 12: 53,140,143 T1447A probably benign Het
Atp13a2 C T 4: 140,994,348 R250C probably damaging Het
Cacna1a T A 8: 84,580,225 probably null Het
Chd6 GATCAT GAT 2: 160,966,552 probably benign Het
Cptp T C 4: 155,867,221 E5G possibly damaging Het
Dnajc16 C A 4: 141,774,611 V303F probably benign Het
Gm10842 T C 11: 105,147,076 S62P unknown Het
Gm17509 T C 13: 117,220,576 probably benign Het
Homer1 C T 13: 93,402,074 Q142* probably null Het
Kcnb2 C A 1: 15,710,835 Q644K possibly damaging Het
Map3k19 T C 1: 127,838,553 probably null Het
Msh4 T A 3: 153,863,491 H621L probably damaging Het
Ogfod1 A T 8: 94,063,052 E460D probably damaging Het
Olfr228 A T 2: 86,483,739 M1K probably null Het
Rp1 G A 1: 4,352,675 R61W probably damaging Het
Scaf4 A T 16: 90,251,938 H329Q unknown Het
Sec61a1 A T 6: 88,512,220 D166E probably damaging Het
Tars2 C T 3: 95,747,640 R63H possibly damaging Het
Vmn1r57 A T 7: 5,220,715 K80* probably null Het
Vmn2r106 A G 17: 20,278,885 W255R probably benign Het
Wdr49 C G 3: 75,333,356 C402S possibly damaging Het
Other mutations in Olfr808
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Olfr808 APN 10 129767586 missense probably null 0.99
IGL01313:Olfr808 APN 10 129767595 missense probably damaging 1.00
IGL01923:Olfr808 APN 10 129768104 missense probably benign 0.01
IGL02010:Olfr808 APN 10 129768267 missense probably benign 0.07
IGL02393:Olfr808 APN 10 129767793 missense probably benign 0.06
IGL03026:Olfr808 APN 10 129768041 missense probably benign 0.00
R1181:Olfr808 UTSW 10 129768164 missense probably benign 0.09
R1760:Olfr808 UTSW 10 129767548 missense probably benign 0.06
R1844:Olfr808 UTSW 10 129767856 missense probably benign 0.03
R2697:Olfr808 UTSW 10 129767924 missense probably benign 0.09
R3414:Olfr808 UTSW 10 129768432 missense probably benign
R5824:Olfr808 UTSW 10 129768381 missense probably damaging 1.00
R6260:Olfr808 UTSW 10 129767520 missense probably benign 0.00
R6723:Olfr808 UTSW 10 129768415 missense probably benign 0.38
R6758:Olfr808 UTSW 10 129768051 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CCCAATTTCAGATCTTAGCTATGC -3'
(R):5'- GGTTTACAGATGGCCACATAACG -3'

Sequencing Primer
(F):5'- CAGATCTTAGCTATGCCAAATAAGAC -3'
(R):5'- TAACGATCATAGGACATTGCAGC -3'
Posted On2015-02-05