Incidental Mutation 'R3025:Homer1'
ID265807
Institutional Source Beutler Lab
Gene Symbol Homer1
Ensembl Gene ENSMUSG00000007617
Gene Namehomer scaffolding protein 1
SynonymsPSD-Zip45, Ves-1
MMRRC Submission 040541-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.445) question?
Stock #R3025 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location93299635-93405129 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 93402074 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 142 (Q142*)
Ref Sequence ENSEMBL: ENSMUSP00000105124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060490] [ENSMUST00000079086] [ENSMUST00000080127] [ENSMUST00000109495] [ENSMUST00000109496] [ENSMUST00000109497] [ENSMUST00000109498]
Predicted Effect probably null
Transcript: ENSMUST00000060490
AA Change: Q304*
SMART Domains Protein: ENSMUSP00000050471
Gene: ENSMUSG00000007617
AA Change: Q304*

DomainStartEndE-ValueType
WH1 1 107 4.27e-46 SMART
low complexity region 255 268 N/A INTRINSIC
PDB:3CVE|D 290 354 2e-34 PDB
Predicted Effect probably null
Transcript: ENSMUST00000079086
AA Change: Q320*
SMART Domains Protein: ENSMUSP00000078093
Gene: ENSMUSG00000007617
AA Change: Q320*

DomainStartEndE-ValueType
WH1 17 123 2.73e-44 SMART
low complexity region 271 284 N/A INTRINSIC
PDB:3CVE|D 306 370 3e-34 PDB
Predicted Effect probably null
Transcript: ENSMUST00000080127
AA Change: Q316*
SMART Domains Protein: ENSMUSP00000079026
Gene: ENSMUSG00000007617
AA Change: Q316*

DomainStartEndE-ValueType
WH1 1 107 4.27e-46 SMART
low complexity region 267 280 N/A INTRINSIC
PDB:3CVE|D 302 366 2e-34 PDB
Predicted Effect silent
Transcript: ENSMUST00000109495
SMART Domains Protein: ENSMUSP00000105121
Gene: ENSMUSG00000007617

DomainStartEndE-ValueType
WH1 1 107 4.27e-46 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109496
AA Change: Q174*
SMART Domains Protein: ENSMUSP00000105122
Gene: ENSMUSG00000007617
AA Change: Q174*

DomainStartEndE-ValueType
WH1 1 107 1.01e-38 SMART
low complexity region 125 138 N/A INTRINSIC
PDB:3CVE|D 160 224 2e-35 PDB
Predicted Effect probably null
Transcript: ENSMUST00000109497
AA Change: Q130*
SMART Domains Protein: ENSMUSP00000105123
Gene: ENSMUSG00000007617
AA Change: Q130*

DomainStartEndE-ValueType
low complexity region 81 94 N/A INTRINSIC
PDB:3CVE|D 116 180 9e-36 PDB
Predicted Effect probably null
Transcript: ENSMUST00000109498
AA Change: Q142*
SMART Domains Protein: ENSMUSP00000105124
Gene: ENSMUSG00000007617
AA Change: Q142*

DomainStartEndE-ValueType
low complexity region 93 106 N/A INTRINSIC
PDB:3CVE|D 128 192 9e-36 PDB
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the homer family of dendritic proteins. Members of this family regulate group 1 metabotrophic glutamate receptor function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit an increase in spontaneous calcium influx in pancreatic acinar cells. Mice homozygous for a knock-out allele exhibit decreased response to formalin-induced pain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace T A 11: 105,974,093 probably null Het
Akap6 A G 12: 53,140,143 T1447A probably benign Het
Atp13a2 C T 4: 140,994,348 R250C probably damaging Het
Cacna1a T A 8: 84,580,225 probably null Het
Chd6 GATCAT GAT 2: 160,966,552 probably benign Het
Cptp T C 4: 155,867,221 E5G possibly damaging Het
Dnajc16 C A 4: 141,774,611 V303F probably benign Het
Gm10842 T C 11: 105,147,076 S62P unknown Het
Gm17509 T C 13: 117,220,576 probably benign Het
Kcnb2 C A 1: 15,710,835 Q644K possibly damaging Het
Map3k19 T C 1: 127,838,553 probably null Het
Msh4 T A 3: 153,863,491 H621L probably damaging Het
Ogfod1 A T 8: 94,063,052 E460D probably damaging Het
Olfr228 A T 2: 86,483,739 M1K probably null Het
Olfr808 T A 10: 129,767,673 F59Y probably damaging Het
Rp1 G A 1: 4,352,675 R61W probably damaging Het
Scaf4 A T 16: 90,251,938 H329Q unknown Het
Sec61a1 A T 6: 88,512,220 D166E probably damaging Het
Tars2 C T 3: 95,747,640 R63H possibly damaging Het
Vmn1r57 A T 7: 5,220,715 K80* probably null Het
Vmn2r106 A G 17: 20,278,885 W255R probably benign Het
Wdr49 C G 3: 75,333,356 C402S possibly damaging Het
Other mutations in Homer1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Homer1 APN 13 93387688 splice site probably benign
IGL00427:Homer1 APN 13 93402114 missense probably benign 0.05
IGL00479:Homer1 APN 13 93346648 missense probably damaging 1.00
R0153:Homer1 UTSW 13 93391746 missense possibly damaging 0.92
R3437:Homer1 UTSW 13 93366421 intron probably benign
R4418:Homer1 UTSW 13 93402069 missense probably damaging 1.00
R4666:Homer1 UTSW 13 93402159 missense probably damaging 0.99
R4718:Homer1 UTSW 13 93391764 missense probably damaging 1.00
R5413:Homer1 UTSW 13 93391779 missense probably benign 0.01
R5665:Homer1 UTSW 13 93356102 missense probably benign 0.03
R5798:Homer1 UTSW 13 93402095 missense probably damaging 1.00
R6092:Homer1 UTSW 13 93366437 intron probably benign
R6486:Homer1 UTSW 13 93391725 missense possibly damaging 0.73
R6617:Homer1 UTSW 13 93341862 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGATGGCTGAATACAAATCTCC -3'
(R):5'- TCTTGGTACGGAGCCCAAAC -3'

Sequencing Primer
(F):5'- GGCTGAATACAAATCTCCTTAAATTG -3'
(R):5'- GACAGACAGCATCTCTCCATCTATTG -3'
Posted On2015-02-05