Incidental Mutation 'R3025:Gm17509'
ID265808
Institutional Source Beutler Lab
Gene Symbol Gm17509
Ensembl Gene ENSMUSG00000091423
Gene Namepredicted gene, 17509
Synonyms
MMRRC Submission 040541-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R3025 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location117218701-117221075 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 117220576 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153512 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022242] [ENSMUST00000165680] [ENSMUST00000225981]
Predicted Effect probably benign
Transcript: ENSMUST00000022242
SMART Domains Protein: ENSMUSP00000022242
Gene: ENSMUSG00000021728

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
IG_like 74 161 3.47e1 SMART
IG 167 258 2.13e-7 SMART
transmembrane domain 267 289 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000165680
AA Change: E92G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224821
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225460
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225648
Predicted Effect probably benign
Transcript: ENSMUST00000225981
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace T A 11: 105,974,093 probably null Het
Akap6 A G 12: 53,140,143 T1447A probably benign Het
Atp13a2 C T 4: 140,994,348 R250C probably damaging Het
Cacna1a T A 8: 84,580,225 probably null Het
Chd6 GATCAT GAT 2: 160,966,552 probably benign Het
Cptp T C 4: 155,867,221 E5G possibly damaging Het
Dnajc16 C A 4: 141,774,611 V303F probably benign Het
Gm10842 T C 11: 105,147,076 S62P unknown Het
Homer1 C T 13: 93,402,074 Q142* probably null Het
Kcnb2 C A 1: 15,710,835 Q644K possibly damaging Het
Map3k19 T C 1: 127,838,553 probably null Het
Msh4 T A 3: 153,863,491 H621L probably damaging Het
Ogfod1 A T 8: 94,063,052 E460D probably damaging Het
Olfr228 A T 2: 86,483,739 M1K probably null Het
Olfr808 T A 10: 129,767,673 F59Y probably damaging Het
Rp1 G A 1: 4,352,675 R61W probably damaging Het
Scaf4 A T 16: 90,251,938 H329Q unknown Het
Sec61a1 A T 6: 88,512,220 D166E probably damaging Het
Tars2 C T 3: 95,747,640 R63H possibly damaging Het
Vmn1r57 A T 7: 5,220,715 K80* probably null Het
Vmn2r106 A G 17: 20,278,885 W255R probably benign Het
Wdr49 C G 3: 75,333,356 C402S possibly damaging Het
Other mutations in Gm17509
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02975:Gm17509 APN 13 117220772 intron probably benign
IGL03108:Gm17509 APN 13 117220844 intron probably benign
Predicted Primers PCR Primer
(F):5'- AGATGTATAGGAGCAGAACTATCCG -3'
(R):5'- GTACACTTGCTGGTAACTGGG -3'

Sequencing Primer
(F):5'- GAGCAGAACTATCCGGTCCTTTTC -3'
(R):5'- TAACTGGGCGCCCACTG -3'
Posted On2015-02-05