Incidental Mutation 'R3025:Scaf4'
ID265809
Institutional Source Beutler Lab
Gene Symbol Scaf4
Ensembl Gene ENSMUSG00000022983
Gene NameSR-related CTD-associated factor 4
SynonymsSfrs15, Sra4, Srsf15
MMRRC Submission 040541-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.486) question?
Stock #R3025 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location90225680-90284503 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 90251938 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 329 (H329Q)
Ref Sequence ENSEMBL: ENSMUSP00000156174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039280] [ENSMUST00000163419] [ENSMUST00000232371]
Predicted Effect unknown
Transcript: ENSMUST00000039280
AA Change: H329Q
SMART Domains Protein: ENSMUSP00000044472
Gene: ENSMUSG00000022983
AA Change: H329Q

DomainStartEndE-ValueType
RPR 6 136 7.8e-48 SMART
low complexity region 190 214 N/A INTRINSIC
low complexity region 272 313 N/A INTRINSIC
low complexity region 360 389 N/A INTRINSIC
low complexity region 390 418 N/A INTRINSIC
low complexity region 420 448 N/A INTRINSIC
low complexity region 496 558 N/A INTRINSIC
RRM 574 643 7.47e-14 SMART
low complexity region 719 757 N/A INTRINSIC
low complexity region 762 829 N/A INTRINSIC
low complexity region 871 886 N/A INTRINSIC
low complexity region 937 980 N/A INTRINSIC
low complexity region 983 997 N/A INTRINSIC
low complexity region 1006 1046 N/A INTRINSIC
low complexity region 1082 1096 N/A INTRINSIC
low complexity region 1111 1145 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000163419
AA Change: H329Q
SMART Domains Protein: ENSMUSP00000132250
Gene: ENSMUSG00000022983
AA Change: H329Q

DomainStartEndE-ValueType
RPR 6 136 7.8e-48 SMART
low complexity region 190 214 N/A INTRINSIC
low complexity region 272 313 N/A INTRINSIC
low complexity region 360 389 N/A INTRINSIC
low complexity region 390 418 N/A INTRINSIC
low complexity region 420 448 N/A INTRINSIC
low complexity region 496 554 N/A INTRINSIC
RRM 570 639 7.47e-14 SMART
low complexity region 715 753 N/A INTRINSIC
low complexity region 758 825 N/A INTRINSIC
low complexity region 845 860 N/A INTRINSIC
low complexity region 911 954 N/A INTRINSIC
low complexity region 957 971 N/A INTRINSIC
low complexity region 980 1020 N/A INTRINSIC
low complexity region 1056 1070 N/A INTRINSIC
low complexity region 1085 1119 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231594
Predicted Effect unknown
Transcript: ENSMUST00000232371
AA Change: H329Q
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene likely encodes a member of the arginine/serine-rich splicing factor family. A similar protein in Rat appears to bind the large subunit of RNA polymerase II and provide a link between transcription and pre-mRNA splicing. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace T A 11: 105,974,093 probably null Het
Akap6 A G 12: 53,140,143 T1447A probably benign Het
Atp13a2 C T 4: 140,994,348 R250C probably damaging Het
Cacna1a T A 8: 84,580,225 probably null Het
Chd6 GATCAT GAT 2: 160,966,552 probably benign Het
Cptp T C 4: 155,867,221 E5G possibly damaging Het
Dnajc16 C A 4: 141,774,611 V303F probably benign Het
Gm10842 T C 11: 105,147,076 S62P unknown Het
Gm17509 T C 13: 117,220,576 probably benign Het
Homer1 C T 13: 93,402,074 Q142* probably null Het
Kcnb2 C A 1: 15,710,835 Q644K possibly damaging Het
Map3k19 T C 1: 127,838,553 probably null Het
Msh4 T A 3: 153,863,491 H621L probably damaging Het
Ogfod1 A T 8: 94,063,052 E460D probably damaging Het
Olfr228 A T 2: 86,483,739 M1K probably null Het
Olfr808 T A 10: 129,767,673 F59Y probably damaging Het
Rp1 G A 1: 4,352,675 R61W probably damaging Het
Sec61a1 A T 6: 88,512,220 D166E probably damaging Het
Tars2 C T 3: 95,747,640 R63H possibly damaging Het
Vmn1r57 A T 7: 5,220,715 K80* probably null Het
Vmn2r106 A G 17: 20,278,885 W255R probably benign Het
Wdr49 C G 3: 75,333,356 C402S possibly damaging Het
Other mutations in Scaf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Scaf4 APN 16 90247281 missense unknown
IGL00536:Scaf4 APN 16 90257362 missense unknown
IGL01122:Scaf4 APN 16 90248630 missense unknown
IGL02015:Scaf4 APN 16 90258846 missense unknown
IGL02074:Scaf4 APN 16 90242920 missense unknown
IGL02555:Scaf4 APN 16 90250305 missense unknown
IGL02735:Scaf4 APN 16 90245515 missense unknown
FR4304:Scaf4 UTSW 16 90229854 small deletion probably benign
FR4589:Scaf4 UTSW 16 90229854 small deletion probably benign
R0217:Scaf4 UTSW 16 90242682 missense probably damaging 0.99
R0410:Scaf4 UTSW 16 90260170 missense unknown
R0681:Scaf4 UTSW 16 90249694 missense unknown
R1099:Scaf4 UTSW 16 90263098 missense unknown
R1510:Scaf4 UTSW 16 90245394 missense unknown
R1694:Scaf4 UTSW 16 90229857 small deletion probably benign
R2077:Scaf4 UTSW 16 90252435 missense unknown
R2087:Scaf4 UTSW 16 90252425 missense unknown
R2182:Scaf4 UTSW 16 90230140 missense probably benign 0.15
R2698:Scaf4 UTSW 16 90244356 missense unknown
R2925:Scaf4 UTSW 16 90250289 missense unknown
R3236:Scaf4 UTSW 16 90260217 missense unknown
R4207:Scaf4 UTSW 16 90260215 missense unknown
R4584:Scaf4 UTSW 16 90229515 unclassified probably benign
R4735:Scaf4 UTSW 16 90252432 missense unknown
R4835:Scaf4 UTSW 16 90250307 missense unknown
R4969:Scaf4 UTSW 16 90251943 nonsense probably null
R5174:Scaf4 UTSW 16 90247174 missense unknown
R5568:Scaf4 UTSW 16 90229857 small deletion probably benign
R5615:Scaf4 UTSW 16 90251960 missense unknown
R5638:Scaf4 UTSW 16 90244310 missense unknown
R6364:Scaf4 UTSW 16 90260248 nonsense probably null
R6470:Scaf4 UTSW 16 90229638 nonsense probably null
X0013:Scaf4 UTSW 16 90252291 missense unknown
Predicted Primers PCR Primer
(F):5'- AACAGCAGTGCTCAGAAGTAC -3'
(R):5'- TGGGAATAGTGTCCTTATCAGAGTTAG -3'

Sequencing Primer
(F):5'- AATGCTTTATGCCCCAGTGTAG -3'
(R):5'- AATTTTAAAATGTGGCATTTGTGTTG -3'
Posted On2015-02-05