Mutagenetix > Incidental Mutation

Incidental Mutation 'R3027:Arap2'

265844

Institutional Source

Beutler Lab

Gene Symbol

Arap2

Ensembl Gene

ENSMUSG00000037999

Gene Name

ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2

Synonyms

Centd1

MMRRC Submission

040543-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3027 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

62759788-62923502 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 62827240 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 993 (T993A)

Ref Sequence

ENSEMBL: ENSMUSP00000075924 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076623]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000076623
AA Change: T993A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000075924
Gene: ENSMUSG00000037999
AA Change: T993A

Domain	Start	End	E-Value	Type
SAM	3	70	3.69e-7	SMART
low complexity region	222	233	N/A	INTRINSIC
PH	481	574	6.45e-17	SMART
PH	586	679	9.05e-12	SMART
ArfGap	684	805	9.2e-33	SMART
PH	891	1003	1.51e-8	SMART
PH	1013	1112	9.21e-4	SMART
RhoGAP	1124	1300	1.36e-50	SMART
Pfam:RA	1325	1416	2.1e-7	PFAM
PH	1429	1533	2.68e-14	SMART
coiled coil region	1561	1590	N/A	INTRINSIC

Meta Mutation Damage Score

0.3870

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

100% (33/33)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains ARF-GAP, RHO-GAP, ankyrin repeat, RAS-associating, and pleckstrin homology domains. The protein is a phosphatidylinositol (3,4,5)-trisphosphate-dependent Arf6 GAP that binds RhoA-GTP, but it lacks the predicted catalytic arginine in the RHO-GAP domain and does not have RHO-GAP activity. The protein associates with focal adhesions and functions downstream of RhoA to regulate focal adhesion dynamics. [provided by RefSeq, Sep 2008]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgap18	G	A	10: 26,722,092 (GRCm39)	G21D	probably benign	Het
Cluap1	T	A	16: 3,729,396 (GRCm39)	C84*	probably null	Het
Dnmt3a	T	A	12: 3,899,626 (GRCm39)		probably null	Het
Etaa1	T	C	11: 17,897,886 (GRCm39)	D146G	probably damaging	Het
Fam227a	T	C	15: 79,532,934 (GRCm39)		probably null	Het
Htt	T	A	5: 34,977,439 (GRCm39)	I775N	possibly damaging	Het
Itgax	C	A	7: 127,747,744 (GRCm39)	Y1053*	probably null	Het
Kif21a	T	A	15: 90,856,845 (GRCm39)	N583Y	probably damaging	Het
Lrp1b	T	A	2: 40,760,283 (GRCm39)	E2995V	probably benign	Het
Or1ad8	G	A	11: 50,897,879 (GRCm39)	V27M	possibly damaging	Het
Or5h22	C	T	16: 58,895,330 (GRCm39)	V38I	probably benign	Het
Or6aa1	T	C	7: 86,043,761 (GRCm39)	N315S	probably benign	Het
Or8k39	C	T	2: 86,563,930 (GRCm39)	V9M	possibly damaging	Het
Otos	A	T	1: 92,572,076 (GRCm39)	H83Q	probably damaging	Het
Pramel7	A	G	2: 87,321,747 (GRCm39)	M96T	probably benign	Het
Ptprz1	T	A	6: 23,016,196 (GRCm39)	S1680T	possibly damaging	Het
Rad50	A	G	11: 53,586,208 (GRCm39)	S263P	probably benign	Het
Resf1	T	C	6: 149,230,533 (GRCm39)	L1193P	probably benign	Het
Retreg2	A	G	1: 75,123,088 (GRCm39)	S339G	probably damaging	Het
Schip1	G	A	3: 68,401,943 (GRCm39)	A7T	probably damaging	Het
Shkbp1	A	C	7: 27,042,818 (GRCm39)	S540A	probably benign	Het
Slc15a4	A	G	5: 127,681,600 (GRCm39)		probably null	Het
Socs1	T	C	16: 10,602,578 (GRCm39)	D53G	possibly damaging	Het
Spag9	G	T	11: 93,977,203 (GRCm39)	R103L	probably null	Het
Spc24	AGAGGTAGTCACTGA	AGA	9: 21,667,511 (GRCm39)		probably null	Het
Spo11	T	C	2: 172,827,736 (GRCm39)	Y146H	probably damaging	Het
Tmem25	T	C	9: 44,709,511 (GRCm39)		probably null	Het
Ttyh1	A	G	7: 4,122,721 (GRCm39)	D23G	probably benign	Het
Vrk3	C	T	7: 44,424,866 (GRCm39)	T427M	probably benign	Het
Zfp513	A	G	5: 31,356,673 (GRCm39)	S540P	possibly damaging	Het
Zfp808	A	T	13: 62,319,404 (GRCm39)	H211L	probably benign	Het

Other mutations in Arap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00481:Arap2	APN	5	62,793,305 (GRCm39)	missense	probably damaging	1.00
IGL00642:Arap2	APN	5	62,890,401 (GRCm39)	nonsense	probably null
IGL00705:Arap2	APN	5	62,835,366 (GRCm39)	missense	probably damaging	1.00
IGL00942:Arap2	APN	5	62,855,732 (GRCm39)	nonsense	probably null
IGL01069:Arap2	APN	5	62,807,199 (GRCm39)	missense	probably benign
IGL01601:Arap2	APN	5	62,798,685 (GRCm39)	missense	probably damaging	1.00
IGL01986:Arap2	APN	5	62,779,265 (GRCm39)	missense	probably damaging	1.00
IGL02032:Arap2	APN	5	62,828,340 (GRCm39)	missense	probably damaging	0.99
IGL02262:Arap2	APN	5	62,800,184 (GRCm39)	missense	probably damaging	1.00
IGL02331:Arap2	APN	5	62,807,025 (GRCm39)	splice site	probably benign
IGL02527:Arap2	APN	5	62,906,650 (GRCm39)	missense	probably benign
IGL02803:Arap2	APN	5	62,906,452 (GRCm39)	missense	probably benign
IGL02864:Arap2	APN	5	62,835,308 (GRCm39)	missense	probably damaging	1.00
IGL03078:Arap2	APN	5	62,890,408 (GRCm39)	splice site	probably benign
IGL03154:Arap2	APN	5	62,800,268 (GRCm39)	missense	probably damaging	1.00
IGL03213:Arap2	APN	5	62,906,438 (GRCm39)	missense	probably benign	0.00
IGL03279:Arap2	APN	5	62,779,253 (GRCm39)	missense	probably damaging	1.00
IGL03288:Arap2	APN	5	62,761,959 (GRCm39)	missense	probably benign	0.00
PIT4354001:Arap2	UTSW	5	62,811,392 (GRCm39)	missense	probably damaging	1.00
R0012:Arap2	UTSW	5	62,840,827 (GRCm39)	missense	probably damaging	1.00
R0013:Arap2	UTSW	5	62,840,827 (GRCm39)	missense	probably damaging	1.00
R0013:Arap2	UTSW	5	62,840,827 (GRCm39)	missense	probably damaging	1.00
R0166:Arap2	UTSW	5	62,833,361 (GRCm39)	missense	probably damaging	1.00
R0472:Arap2	UTSW	5	62,864,002 (GRCm39)	missense	probably damaging	1.00
R0506:Arap2	UTSW	5	62,763,474 (GRCm39)	missense	possibly damaging	0.87
R0551:Arap2	UTSW	5	62,798,666 (GRCm39)	splice site	probably null
R0607:Arap2	UTSW	5	62,763,474 (GRCm39)	missense	possibly damaging	0.87
R0617:Arap2	UTSW	5	62,807,250 (GRCm39)	splice site	probably benign
R0975:Arap2	UTSW	5	62,888,229 (GRCm39)	splice site	probably benign
R0976:Arap2	UTSW	5	62,807,227 (GRCm39)	missense	probably damaging	1.00
R1164:Arap2	UTSW	5	62,840,820 (GRCm39)	missense	probably damaging	1.00
R1268:Arap2	UTSW	5	62,887,964 (GRCm39)	missense	probably benign	0.00
R1480:Arap2	UTSW	5	62,826,472 (GRCm39)	nonsense	probably null
R1502:Arap2	UTSW	5	62,761,747 (GRCm39)	missense	probably benign	0.00
R1543:Arap2	UTSW	5	62,763,498 (GRCm39)	nonsense	probably null
R1865:Arap2	UTSW	5	62,855,606 (GRCm39)	missense	probably damaging	0.97
R1962:Arap2	UTSW	5	62,834,007 (GRCm39)	missense	possibly damaging	0.82
R2040:Arap2	UTSW	5	62,906,259 (GRCm39)	missense	probably damaging	0.99
R2118:Arap2	UTSW	5	62,864,028 (GRCm39)	missense	probably damaging	1.00
R2131:Arap2	UTSW	5	62,835,301 (GRCm39)	missense	probably damaging	1.00
R2201:Arap2	UTSW	5	62,864,028 (GRCm39)	missense	probably damaging	1.00
R2215:Arap2	UTSW	5	62,834,519 (GRCm39)	missense	probably damaging	1.00
R3053:Arap2	UTSW	5	62,906,200 (GRCm39)	missense	probably benign	0.35
R3975:Arap2	UTSW	5	62,906,237 (GRCm39)	missense	possibly damaging	0.87
R4272:Arap2	UTSW	5	62,828,322 (GRCm39)	missense	possibly damaging	0.63
R4273:Arap2	UTSW	5	62,828,322 (GRCm39)	missense	possibly damaging	0.63
R4326:Arap2	UTSW	5	62,779,206 (GRCm39)	missense	possibly damaging	0.50
R4327:Arap2	UTSW	5	62,779,206 (GRCm39)	missense	possibly damaging	0.50
R4328:Arap2	UTSW	5	62,779,206 (GRCm39)	missense	possibly damaging	0.50
R4451:Arap2	UTSW	5	62,906,513 (GRCm39)	missense	probably benign	0.06
R4659:Arap2	UTSW	5	62,811,469 (GRCm39)	missense	possibly damaging	0.94
R4665:Arap2	UTSW	5	62,827,312 (GRCm39)	missense	possibly damaging	0.95
R4715:Arap2	UTSW	5	62,906,437 (GRCm39)	missense	probably benign	0.43
R4808:Arap2	UTSW	5	62,887,984 (GRCm39)	missense	probably benign	0.23
R4941:Arap2	UTSW	5	62,906,821 (GRCm39)	missense	probably benign	0.20
R4983:Arap2	UTSW	5	62,833,868 (GRCm39)	missense	probably damaging	0.98
R5095:Arap2	UTSW	5	62,811,392 (GRCm39)	missense	probably damaging	1.00
R5156:Arap2	UTSW	5	62,826,524 (GRCm39)	nonsense	probably null
R5201:Arap2	UTSW	5	62,840,832 (GRCm39)	missense	probably damaging	1.00
R5346:Arap2	UTSW	5	62,872,089 (GRCm39)	missense	probably benign	0.39
R5359:Arap2	UTSW	5	62,840,762 (GRCm39)	nonsense	probably null
R5426:Arap2	UTSW	5	62,800,159 (GRCm39)	missense	probably benign	0.02
R5503:Arap2	UTSW	5	62,787,529 (GRCm39)	missense	probably damaging	1.00
R5605:Arap2	UTSW	5	62,772,410 (GRCm39)	missense	possibly damaging	0.47
R5764:Arap2	UTSW	5	62,800,197 (GRCm39)	missense	probably damaging	1.00
R5813:Arap2	UTSW	5	62,834,506 (GRCm39)	missense	probably damaging	1.00
R5846:Arap2	UTSW	5	62,807,116 (GRCm39)	missense	probably damaging	1.00
R6084:Arap2	UTSW	5	62,828,297 (GRCm39)	missense	possibly damaging	0.89
R6173:Arap2	UTSW	5	62,906,965 (GRCm39)	missense	probably damaging	1.00
R6175:Arap2	UTSW	5	62,872,074 (GRCm39)	critical splice donor site	probably null
R6249:Arap2	UTSW	5	62,803,536 (GRCm39)	missense	probably damaging	0.99
R6386:Arap2	UTSW	5	62,761,865 (GRCm39)	missense	possibly damaging	0.89
R6424:Arap2	UTSW	5	62,840,707 (GRCm39)	missense	probably damaging	1.00
R6744:Arap2	UTSW	5	62,906,281 (GRCm39)	missense	probably damaging	1.00
R6766:Arap2	UTSW	5	62,834,443 (GRCm39)	critical splice donor site	probably null
R6990:Arap2	UTSW	5	62,833,860 (GRCm39)	missense	probably damaging	0.96
R7067:Arap2	UTSW	5	62,811,387 (GRCm39)	critical splice donor site	probably null
R7098:Arap2	UTSW	5	62,833,293 (GRCm39)	critical splice donor site	probably null
R7107:Arap2	UTSW	5	62,763,551 (GRCm39)	missense	probably damaging	0.98
R7156:Arap2	UTSW	5	62,761,914 (GRCm39)	missense	probably damaging	1.00
R7174:Arap2	UTSW	5	62,761,621 (GRCm39)	missense	probably benign
R7187:Arap2	UTSW	5	62,826,396 (GRCm39)	missense	probably damaging	0.99
R7197:Arap2	UTSW	5	62,798,729 (GRCm39)	missense	possibly damaging	0.89
R7214:Arap2	UTSW	5	62,906,681 (GRCm39)	missense	probably benign	0.00
R7317:Arap2	UTSW	5	62,807,067 (GRCm39)	missense	probably damaging	1.00
R7392:Arap2	UTSW	5	62,855,728 (GRCm39)	missense	possibly damaging	0.54
R7438:Arap2	UTSW	5	62,906,818 (GRCm39)	missense	probably damaging	0.99
R7452:Arap2	UTSW	5	62,833,892 (GRCm39)	missense	probably benign	0.00
R7495:Arap2	UTSW	5	62,833,893 (GRCm39)	missense	possibly damaging	0.78
R7796:Arap2	UTSW	5	62,888,105 (GRCm39)	missense	probably damaging	1.00
R7936:Arap2	UTSW	5	62,888,048 (GRCm39)	missense	probably damaging	0.96
R8116:Arap2	UTSW	5	62,887,954 (GRCm39)	missense	probably benign	0.00
R8172:Arap2	UTSW	5	62,779,324 (GRCm39)	splice site	probably null
R8277:Arap2	UTSW	5	62,771,335 (GRCm39)	critical splice donor site	probably null
R8369:Arap2	UTSW	5	62,761,669 (GRCm39)	nonsense	probably null
R8398:Arap2	UTSW	5	62,906,252 (GRCm39)	missense	probably damaging	1.00
R8893:Arap2	UTSW	5	62,888,037 (GRCm39)	missense	probably damaging	1.00
R8973:Arap2	UTSW	5	62,855,668 (GRCm39)	nonsense	probably null
R9102:Arap2	UTSW	5	62,906,341 (GRCm39)	missense	probably benign	0.03
R9121:Arap2	UTSW	5	62,906,326 (GRCm39)	missense	possibly damaging	0.84
R9174:Arap2	UTSW	5	62,855,606 (GRCm39)	missense	probably damaging	1.00
R9222:Arap2	UTSW	5	62,828,421 (GRCm39)	missense	possibly damaging	0.96
R9281:Arap2	UTSW	5	62,906,848 (GRCm39)	missense	probably damaging	0.97
R9399:Arap2	UTSW	5	62,763,455 (GRCm39)	missense	possibly damaging	0.62
R9450:Arap2	UTSW	5	62,855,762 (GRCm39)	missense	probably benign	0.16
R9467:Arap2	UTSW	5	62,887,900 (GRCm39)	missense	probably benign	0.00
R9567:Arap2	UTSW	5	62,761,841 (GRCm39)	missense	probably benign	0.01
R9577:Arap2	UTSW	5	62,769,060 (GRCm39)	missense	probably damaging	1.00
R9626:Arap2	UTSW	5	62,906,878 (GRCm39)	missense	probably benign	0.00
R9688:Arap2	UTSW	5	62,872,109 (GRCm39)	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AGGCCCTAGAAAATCTGCTTTTAAC -3'
(R):5'- GGGATGCCGATCTACAATATCTTAC -3'

Sequencing Primer
(F):5'- AACAGTTTTTGATGGCCGAC -3'
(R):5'- GCCGATCTACAATATCTTACTGTTTG -3'

Posted On

2015-02-05