Incidental Mutation 'R3027:Itgax'
ID265853
Institutional Source Beutler Lab
Gene Symbol Itgax
Ensembl Gene ENSMUSG00000030789
Gene Nameintegrin alpha X
SynonymsCd11c, CD11C (p150) alpha polypeptide
MMRRC Submission 040543-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R3027 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location128129547-128150657 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 128148572 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 1053 (Y1053*)
Ref Sequence ENSEMBL: ENSMUSP00000033053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033053]
Predicted Effect probably null
Transcript: ENSMUST00000033053
AA Change: Y1053*
SMART Domains Protein: ENSMUSP00000033053
Gene: ENSMUSG00000030789
AA Change: Y1053*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Int_alpha 33 83 1.28e1 SMART
VWA 150 331 8.36e-43 SMART
Int_alpha 402 451 3.67e-3 SMART
Int_alpha 455 512 1.29e-7 SMART
Int_alpha 518 574 5.72e-14 SMART
Int_alpha 581 635 1.55e-1 SMART
transmembrane domain 1115 1137 N/A INTRINSIC
Pfam:Integrin_alpha 1138 1152 6.2e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206396
Meta Mutation Damage Score 0.6216 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the integrin alpha X chain protein. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein combines with the beta 2 chain (ITGB2) to form a leukocyte-specific integrin referred to as inactivated-C3b (iC3b) receptor 4 (CR4). The alpha X beta 2 complex seems to overlap the properties of the alpha M beta 2 integrin in the adherence of neutrophils and monocytes to stimulated endothelium cells, and in the phagocytosis of complement coated particles. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to bacterial infection, decreased susceptibility to experimental autoimmune encephalomyelitis (EAE), increased T cell proliferation, and an abnormal pattern of cytokine production during EAE. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,329,035 L1193P probably benign Het
Arap2 T C 5: 62,669,897 T993A probably damaging Het
Arhgap18 G A 10: 26,846,096 G21D probably benign Het
Cluap1 T A 16: 3,911,532 C84* probably null Het
Dnmt3a T A 12: 3,849,626 probably null Het
Etaa1 T C 11: 17,947,886 D146G probably damaging Het
Fam227a T C 15: 79,648,733 probably null Het
Htt T A 5: 34,820,095 I775N possibly damaging Het
Kif21a T A 15: 90,972,642 N583Y probably damaging Het
Lrp1b T A 2: 40,870,271 E2995V probably benign Het
Olfr1089 C T 2: 86,733,586 V9M possibly damaging Het
Olfr190 C T 16: 59,074,967 V38I probably benign Het
Olfr303 T C 7: 86,394,553 N315S probably benign Het
Olfr51 G A 11: 51,007,052 V27M possibly damaging Het
Otos A T 1: 92,644,354 H83Q probably damaging Het
Pramel7 A G 2: 87,491,403 M96T probably benign Het
Ptprz1 T A 6: 23,016,197 S1680T possibly damaging Het
Rad50 A G 11: 53,695,381 S263P probably benign Het
Retreg2 A G 1: 75,146,444 S339G probably damaging Het
Schip1 G A 3: 68,494,610 A7T probably damaging Het
Shkbp1 A C 7: 27,343,393 S540A probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Socs1 T C 16: 10,784,714 D53G possibly damaging Het
Spag9 G T 11: 94,086,377 R103L probably null Het
Spc24 AGAGGTAGTCACTGA AGA 9: 21,756,215 probably null Het
Spo11 T C 2: 172,985,943 Y146H probably damaging Het
Tmem25 T C 9: 44,798,214 probably null Het
Ttyh1 A G 7: 4,119,722 D23G probably benign Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zfp513 A G 5: 31,199,329 S540P possibly damaging Het
Zfp808 A T 13: 62,171,590 H211L probably benign Het
Other mutations in Itgax
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Itgax APN 7 128135326 missense probably damaging 1.00
IGL00325:Itgax APN 7 128148309 missense possibly damaging 0.69
IGL01155:Itgax APN 7 128145035 missense probably benign 0.00
IGL01461:Itgax APN 7 128135018 missense probably damaging 1.00
IGL01508:Itgax APN 7 128144818 missense probably damaging 1.00
IGL01549:Itgax APN 7 128131206 splice site probably null
IGL01864:Itgax APN 7 128133763 missense probably benign 0.00
IGL02094:Itgax APN 7 128131473 missense probably damaging 1.00
IGL02364:Itgax APN 7 128139982 missense possibly damaging 0.89
IGL02969:Itgax APN 7 128149123 missense probably benign
IGL03406:Itgax APN 7 128149198 missense possibly damaging 0.93
Adendritic UTSW 7 128148572 nonsense probably null
PIT4651001:Itgax UTSW 7 128149110 missense probably benign 0.11
R0366:Itgax UTSW 7 128149089 splice site probably benign
R0763:Itgax UTSW 7 128147940 splice site probably benign
R1072:Itgax UTSW 7 128150144 missense probably damaging 0.96
R1659:Itgax UTSW 7 128130891 missense probably benign 0.15
R2019:Itgax UTSW 7 128148526 missense probably benign
R2418:Itgax UTSW 7 128142333 missense probably damaging 0.98
R3846:Itgax UTSW 7 128133767 missense probably damaging 1.00
R3938:Itgax UTSW 7 128136273 missense possibly damaging 0.73
R4021:Itgax UTSW 7 128133139 critical splice donor site probably null
R4027:Itgax UTSW 7 128141266 missense possibly damaging 0.75
R4163:Itgax UTSW 7 128144700 missense probably benign 0.00
R4923:Itgax UTSW 7 128148528 missense probably benign
R5259:Itgax UTSW 7 128148278 missense probably damaging 0.99
R5333:Itgax UTSW 7 128142283 missense probably damaging 1.00
R5347:Itgax UTSW 7 128141302 missense probably benign 0.08
R5679:Itgax UTSW 7 128134990 missense probably benign 0.00
R5725:Itgax UTSW 7 128147861 missense possibly damaging 0.63
R5733:Itgax UTSW 7 128140475 missense probably damaging 0.99
R5750:Itgax UTSW 7 128144706 missense probably benign 0.32
R5964:Itgax UTSW 7 128140447 missense probably damaging 1.00
R6004:Itgax UTSW 7 128131452 missense probably damaging 0.96
R6168:Itgax UTSW 7 128133097 missense probably damaging 0.99
R6212:Itgax UTSW 7 128130332 missense possibly damaging 0.52
R6212:Itgax UTSW 7 128147853 missense probably benign 0.16
R6480:Itgax UTSW 7 128148599 missense probably benign 0.12
R6484:Itgax UTSW 7 128133718 missense probably benign 0.13
R6796:Itgax UTSW 7 128135064 missense probably damaging 1.00
R6844:Itgax UTSW 7 128147934 splice site probably null
R7287:Itgax UTSW 7 128148505 missense probably damaging 1.00
R7365:Itgax UTSW 7 128135309 missense probably damaging 1.00
R7421:Itgax UTSW 7 128140432 missense probably damaging 1.00
X0061:Itgax UTSW 7 128129607 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TCTGCACCAGCTCTATCGAG -3'
(R):5'- AATGTGATTTCAGCCTCACTCAG -3'

Sequencing Primer
(F):5'- AGCTCTATCGAGGCCTGCATG -3'
(R):5'- GGAGCAACACCTTTTTCTGCAATG -3'
Posted On2015-02-05