Incidental Mutation 'R2037:Cbx3'
ID266050
Institutional Source Beutler Lab
Gene Symbol Cbx3
Ensembl Gene ENSMUSG00000029836
Gene Namechromobox 3
Synonymsheterochromatin protein 1 gamma, M32, HP1g
MMRRC Submission 040044-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.515) question?
Stock #R2037 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location51470360-51483704 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 51471813 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031862] [ENSMUST00000069949] [ENSMUST00000090002] [ENSMUST00000094623] [ENSMUST00000114445] [ENSMUST00000114445] [ENSMUST00000114446] [ENSMUST00000114446] [ENSMUST00000114459] [ENSMUST00000141711] [ENSMUST00000141711] [ENSMUST00000203220] [ENSMUST00000203954] [ENSMUST00000204158] [ENSMUST00000204188]
Predicted Effect probably null
Transcript: ENSMUST00000031862
SMART Domains Protein: ENSMUSP00000031862
Gene: ENSMUSG00000029836

DomainStartEndE-ValueType
CHROMO 29 81 2.03e-17 SMART
low complexity region 90 113 N/A INTRINSIC
ChSh 115 177 6.46e-34 SMART
CHROMO 120 172 5.92e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069949
SMART Domains Protein: ENSMUSP00000067491
Gene: ENSMUSG00000004980

DomainStartEndE-ValueType
RRM 10 82 1.51e-23 SMART
RRM 101 173 7.64e-20 SMART
Pfam:HnRNPA1 245 282 5.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090002
SMART Domains Protein: ENSMUSP00000087453
Gene: ENSMUSG00000004980

DomainStartEndE-ValueType
RRM 10 82 1.51e-23 SMART
RRM 101 173 7.64e-20 SMART
low complexity region 186 295 N/A INTRINSIC
low complexity region 310 341 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000094623
SMART Domains Protein: ENSMUSP00000110091
Gene: ENSMUSG00000029836

DomainStartEndE-ValueType
CHROMO 29 81 2.03e-17 SMART
low complexity region 90 113 N/A INTRINSIC
ChSh 115 177 6.46e-34 SMART
CHROMO 120 172 5.92e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114445
SMART Domains Protein: ENSMUSP00000110088
Gene: ENSMUSG00000029836

DomainStartEndE-ValueType
Pfam:Chromo 30 60 1.4e-6 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000114445
SMART Domains Protein: ENSMUSP00000110088
Gene: ENSMUSG00000029836

DomainStartEndE-ValueType
Pfam:Chromo 30 60 1.4e-6 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000114446
SMART Domains Protein: ENSMUSP00000110089
Gene: ENSMUSG00000029836

DomainStartEndE-ValueType
CHROMO 29 81 2.03e-17 SMART
low complexity region 90 113 N/A INTRINSIC
ChSh 115 177 6.46e-34 SMART
CHROMO 120 172 5.92e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114446
SMART Domains Protein: ENSMUSP00000110089
Gene: ENSMUSG00000029836

DomainStartEndE-ValueType
CHROMO 29 81 2.03e-17 SMART
low complexity region 90 113 N/A INTRINSIC
ChSh 115 177 6.46e-34 SMART
CHROMO 120 172 5.92e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114459
SMART Domains Protein: ENSMUSP00000110103
Gene: ENSMUSG00000004980

DomainStartEndE-ValueType
RRM 10 82 1.51e-23 SMART
RRM 101 173 7.64e-20 SMART
low complexity region 186 295 N/A INTRINSIC
low complexity region 310 341 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000141711
SMART Domains Protein: ENSMUSP00000121370
Gene: ENSMUSG00000029836

DomainStartEndE-ValueType
CHROMO 29 81 2.03e-17 SMART
low complexity region 90 109 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000141711
SMART Domains Protein: ENSMUSP00000121370
Gene: ENSMUSG00000029836

DomainStartEndE-ValueType
CHROMO 29 81 2.03e-17 SMART
low complexity region 90 109 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156463
Predicted Effect probably benign
Transcript: ENSMUST00000203220
SMART Domains Protein: ENSMUSP00000145374
Gene: ENSMUSG00000004980

DomainStartEndE-ValueType
RRM 10 82 1.51e-23 SMART
RRM 101 173 7.64e-20 SMART
low complexity region 186 295 N/A INTRINSIC
low complexity region 310 341 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203954
SMART Domains Protein: ENSMUSP00000145028
Gene: ENSMUSG00000004980

DomainStartEndE-ValueType
RRM 22 94 1.51e-23 SMART
RRM 113 185 7.64e-20 SMART
low complexity region 198 307 N/A INTRINSIC
low complexity region 322 353 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204158
SMART Domains Protein: ENSMUSP00000145383
Gene: ENSMUSG00000004980

DomainStartEndE-ValueType
RRM 10 82 1.51e-23 SMART
RRM 101 173 7.64e-20 SMART
Pfam:HnRNPA1 245 282 9.5e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204188
SMART Domains Protein: ENSMUSP00000145245
Gene: ENSMUSG00000004980

DomainStartEndE-ValueType
RRM 10 82 1.51e-23 SMART
RRM 101 173 7.64e-20 SMART
Pfam:HnRNPA1 245 282 9.5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205204
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] At the nuclear envelope, the nuclear lamina and heterochromatin are adjacent to the inner nuclear membrane. The protein encoded by this gene binds DNA and is a component of heterochromatin. This protein also can bind lamin B receptor, an integral membrane protein found in the inner nuclear membrane. The dual binding functions of the encoded protein may explain the association of heterochromatin with the inner nuclear membrane. This protein binds histone H3 tails methylated at Lys-9 sites. This protein is also recruited to sites of ultraviolet-induced DNA damage and double-strand breaks. Two transcript variants encoding the same protein but differing in the 5' UTR, have been found for this gene.[provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a gene trap allele are infertile. Mice homozygous for a hypomorphic targeted allele exhibit partial postnatal lethality and male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,089,984 probably null Het
AI987944 T C 7: 41,374,391 Y391C probably benign Het
Ankfn1 A T 11: 89,456,120 S296T probably benign Het
Apob A G 12: 8,007,488 D1957G probably benign Het
Baz1a G T 12: 54,929,646 P415Q probably damaging Het
Brca2 T A 5: 150,540,669 H1299Q probably benign Het
C7 G T 15: 5,034,238 S227* probably null Het
Catsperb A T 12: 101,507,962 R306S probably damaging Het
Ccdc129 A G 6: 55,897,875 N270S probably benign Het
Ccnt2 A G 1: 127,803,399 Y671C probably damaging Het
Crocc A G 4: 141,046,942 probably null Het
Ctr9 G A 7: 111,046,807 V669I probably benign Het
Dck T G 5: 88,772,717 Y99D probably damaging Het
Ddx52 T A 11: 83,944,606 D119E probably benign Het
Dnah10 A T 5: 124,746,704 K596N probably benign Het
Dnah7a A T 1: 53,582,582 V1128E probably benign Het
Dph1 A T 11: 75,185,853 probably null Het
Enah G A 1: 181,921,972 P415L probably damaging Het
Enthd1 A G 15: 80,560,349 S2P possibly damaging Het
Erc1 A C 6: 119,722,255 V802G possibly damaging Het
F8 ATCTCTCTC ATCTCTC X: 75,322,998 probably null Het
Fam169a C A 13: 97,107,092 A210E probably benign Het
Fcmr A G 1: 130,878,333 D342G possibly damaging Het
Fgfr4 T G 13: 55,167,889 V743G possibly damaging Het
Fsip2 A G 2: 82,978,512 D1725G probably damaging Het
Heatr5b A T 17: 78,829,505 C195* probably null Het
Herc2 G A 7: 56,205,961 A3882T probably damaging Het
Il20 T A 1: 130,908,378 N143Y probably damaging Het
Inpp5b A G 4: 124,798,299 S892G probably damaging Het
Ipo13 A T 4: 117,904,661 Y447* probably null Het
Kbtbd12 A T 6: 88,617,797 N350K probably benign Het
Kiz T C 2: 146,969,960 F663S probably damaging Het
Matn2 A G 15: 34,433,117 D870G probably benign Het
Methig1 C T 15: 100,353,586 A126V probably benign Het
Mme A G 3: 63,328,260 D209G probably null Het
Mroh4 A G 15: 74,609,761 F811L possibly damaging Het
Myo9b G T 8: 71,290,866 K190N probably damaging Het
Ncf1 T C 5: 134,229,552 I6V probably damaging Het
Nmt2 T C 2: 3,309,581 F121L probably damaging Het
Nol10 A G 12: 17,361,151 D183G probably benign Het
Nsun7 T C 5: 66,261,086 V53A probably benign Het
Olfr1045 T C 2: 86,197,832 S307G probably benign Het
Olfr1054 T C 2: 86,332,430 N309D probably benign Het
Olfr819 T C 10: 129,966,140 I187V probably benign Het
Pappa2 A T 1: 158,956,644 Y265* probably null Het
Pigg G A 5: 108,338,652 A724T probably damaging Het
Pik3r4 C T 9: 105,650,335 R296C probably benign Het
Pkhd1l1 A G 15: 44,568,221 probably null Het
Pld4 A G 12: 112,768,558 D483G probably damaging Het
Ppip5k1 C T 2: 121,343,193 R399H probably damaging Het
Qrfpr A T 3: 36,182,657 H198Q probably damaging Het
Rasgrf2 A T 13: 91,902,629 D883E probably damaging Het
Retnlg T C 16: 48,874,252 C88R probably damaging Het
Sin3a C T 9: 57,096,825 T287I probably benign Het
Slc44a1 GCC GCCCCC 4: 53,563,243 probably benign Het
Sppl2c G C 11: 104,186,481 V36L probably benign Het
Srp72 T A 5: 76,976,491 I68N probably damaging Het
Srrm3 T A 5: 135,854,377 S195R probably damaging Het
Srrm4 T A 5: 116,467,828 probably benign Het
Ssb A G 2: 69,868,819 S199G probably benign Het
Sult2a6 T A 7: 14,254,709 Y42F probably damaging Het
Syne2 A G 12: 76,025,569 T120A probably benign Het
Tas1r1 A G 4: 152,028,170 F809L probably damaging Het
Tead3 A G 17: 28,336,570 S117P probably damaging Het
Tefm C T 11: 80,140,230 R60H probably damaging Het
Tmem104 G A 11: 115,201,395 R110H possibly damaging Het
Tnxb G A 17: 34,699,205 G2364D probably damaging Het
Vmn1r211 T A 13: 22,851,964 I178F probably damaging Het
Vmn1r6 A T 6: 57,003,124 Y235F probably damaging Het
Xrcc5 C A 1: 72,346,370 T540K probably benign Het
Other mutations in Cbx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:Cbx3 APN 6 51475301 missense probably damaging 0.97
R4877:Cbx3 UTSW 6 51482560 missense possibly damaging 0.59
R5138:Cbx3 UTSW 6 51475289 missense probably damaging 1.00
R5518:Cbx3 UTSW 6 51481746 missense probably benign 0.12
R7350:Cbx3 UTSW 6 51475375 critical splice donor site probably null
X0020:Cbx3 UTSW 6 51481752 missense probably benign 0.20
X0025:Cbx3 UTSW 6 51482515 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AAGTTGTCTGAGGTACCAGTG -3'
(R):5'- TCCACCACAGGTTCTAGCTC -3'

Sequencing Primer
(F):5'- TCTGAGGTACCAGTGTTTTAGTAAG -3'
(R):5'- TCACAAACTTACCAATGTAGT -3'
Posted On2015-02-05