Incidental Mutation 'R2483:Vps37c'
ID266147
Institutional Source Beutler Lab
Gene Symbol Vps37c
Ensembl Gene ENSMUSG00000048832
Gene Namevacuolar protein sorting 37C
Synonyms
MMRRC Submission 040407-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R2483 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location10688815-10714419 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 10706205 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000085264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087951]
Predicted Effect probably null
Transcript: ENSMUST00000087951
SMART Domains Protein: ENSMUSP00000085264
Gene: ENSMUSG00000048832

DomainStartEndE-ValueType
Pfam:Mod_r 5 150 2.4e-39 PFAM
low complexity region 171 216 N/A INTRINSIC
low complexity region 233 250 N/A INTRINSIC
low complexity region 310 338 N/A INTRINSIC
Meta Mutation Damage Score 0.6272 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] VPS37C is a subunit of ESCRT-I (endosomal sorting complex required for transport I), a complex in the class E vacuolar protein sorting (VPS) pathway required for sorting ubiquitinated transmembrane proteins into internal vesicles of multivesicular bodies (Eastman et al., 2005 [PubMed 15509564]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230050P20Rik A T 9: 20,873,177 I186F possibly damaging Het
Adcy1 A G 11: 7,130,348 T364A probably benign Het
Adpgk G A 9: 59,313,753 V281I probably benign Het
Akap9 C A 5: 3,976,235 Q1297K possibly damaging Het
Ankrd13d T C 19: 4,281,940 E110G probably damaging Het
Ankrd53 A G 6: 83,763,262 E104G possibly damaging Het
Ano6 A T 15: 95,965,974 T792S probably benign Het
Atm A T 9: 53,510,266 V715D probably damaging Het
Avl9 A G 6: 56,736,843 D362G probably benign Het
Bin1 T A 18: 32,414,227 S152R probably damaging Het
Bscl2 T A 19: 8,841,150 C40S probably benign Het
Btaf1 A G 19: 36,981,086 T668A probably benign Het
Btrc A G 19: 45,516,058 D397G probably damaging Het
C530008M17Rik A T 5: 76,856,409 I206F probably damaging Het
Cables2 A T 2: 180,260,429 V379E probably damaging Het
Cacna2d2 T C 9: 107,512,022 L228P probably damaging Het
Cd109 A T 9: 78,667,357 D541V probably damaging Het
Cdh26 A T 2: 178,466,589 S327C probably damaging Het
Cep78 T C 19: 15,960,980 K535E probably damaging Het
Ces1a A G 8: 93,027,341 Y345H probably damaging Het
Col6a5 C A 9: 105,864,148 R2524I probably damaging Het
Dctn1 G A 6: 83,194,187 R661H probably damaging Het
Ddias T C 7: 92,859,592 T372A probably benign Het
Dffb T C 4: 153,965,519 T296A probably damaging Het
Dock8 A G 19: 25,079,877 Q216R probably benign Het
Emx1 T C 6: 85,188,255 S105P probably benign Het
Ep400 T C 5: 110,719,236 Y1014C unknown Het
Fam193a A T 5: 34,465,758 K1230M possibly damaging Het
Fgf9 A G 14: 58,109,571 Q207R probably benign Het
Gm5460 G A 14: 34,045,818 C461Y possibly damaging Het
Gpc1 T C 1: 92,855,938 I249T probably benign Het
Htr1d T C 4: 136,443,504 I348T probably damaging Het
Hyal4 A T 6: 24,765,738 S364C probably damaging Het
Igfn1 T C 1: 135,969,537 E1097G probably benign Het
Igkv1-133 A T 6: 67,724,960 Q16L probably benign Het
Kcnh5 A T 12: 75,114,471 I221N probably damaging Het
Kmt2a A G 9: 44,848,966 Y529H probably damaging Het
Kyat1 T C 2: 30,186,698 H218R possibly damaging Het
Lamb2 T G 9: 108,480,559 C94G probably damaging Het
Met A T 6: 17,549,086 D979V probably damaging Het
Midn A G 10: 80,150,310 D78G probably benign Het
Myh1 A T 11: 67,211,226 M811L probably benign Het
Myh7 T C 14: 54,973,381 E1693G probably damaging Het
Myo15b A G 11: 115,864,739 T979A probably benign Het
Myo18b A T 5: 112,858,408 C879S probably damaging Het
Myom1 A G 17: 71,077,812 T733A probably damaging Het
Ndufa9 A T 6: 126,844,399 M76K possibly damaging Het
Nectin3 A G 16: 46,395,179 C74R possibly damaging Het
Obscn A G 11: 59,080,146 F2514L probably damaging Het
Olfr1241 G A 2: 89,483,127 Q3* probably null Het
Olfr510 CAAATA CA 7: 108,667,662 probably null Het
Olfr653 T C 7: 104,579,942 S99P probably damaging Het
P2ry2 A T 7: 100,998,499 S200T probably benign Het
Pcdha5 G T 18: 36,961,489 M350I probably benign Het
Pcdha5 G A 18: 36,961,781 V448M probably damaging Het
Pex12 C T 11: 83,297,629 R180H possibly damaging Het
Pkd1l1 A T 11: 8,962,701 V168E probably damaging Het
Prokr2 T A 2: 132,381,175 D149V probably damaging Het
Rnf123 A G 9: 108,063,521 V707A probably benign Het
Ryr2 T C 13: 11,759,703 E1189G probably damaging Het
Scarf1 T C 11: 75,515,291 F134L probably damaging Het
Sfxn5 A G 6: 85,332,278 probably null Het
Slc17a5 A T 9: 78,538,274 V433D probably damaging Het
Snapc1 A G 12: 73,964,643 T28A probably benign Het
Soat1 T C 1: 156,431,099 Y528C probably damaging Het
Spem1 G A 11: 69,821,518 R107C possibly damaging Het
Srcap T C 7: 127,542,147 S1639P probably damaging Het
Sycp2 A T 2: 178,374,595 N691K probably damaging Het
Syne2 A T 12: 76,095,537 I6183F probably damaging Het
Tas2r110 A T 6: 132,868,470 M155L probably benign Het
Tenm3 G A 8: 48,240,270 T1859I probably damaging Het
Thsd7b T A 1: 130,103,072 V1048D probably damaging Het
Tmem55b C G 14: 50,930,292 V59L probably damaging Het
Ttc37 A G 13: 76,182,867 E1472G probably damaging Het
Vav3 T C 3: 109,341,166 L43P probably damaging Het
Vmn1r30 A T 6: 58,435,452 F132I probably benign Het
Vmn2r24 A G 6: 123,816,038 R775G probably damaging Het
Vps13c T A 9: 67,975,907 probably null Het
Wwp2 A G 8: 107,548,535 D388G probably damaging Het
Xirp2 A T 2: 67,524,992 T3366S probably benign Het
Zbtb49 A C 5: 38,203,357 probably benign Het
Other mutations in Vps37c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Vps37c APN 19 10710417 missense probably damaging 0.99
R0433:Vps37c UTSW 19 10713029 missense probably benign
R2348:Vps37c UTSW 19 10706300 missense probably damaging 1.00
R3623:Vps37c UTSW 19 10706205 splice site probably null
R3714:Vps37c UTSW 19 10706268 missense probably damaging 1.00
R4650:Vps37c UTSW 19 10712909 missense probably benign 0.31
R4684:Vps37c UTSW 19 10712768 missense probably benign
R7000:Vps37c UTSW 19 10710329 missense probably damaging 1.00
R7026:Vps37c UTSW 19 10706268 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGTCTGTATCCCTGCAGCC -3'
(R):5'- AGGGACCCTAAGTGACCAATTAC -3'

Sequencing Primer
(F):5'- TATCCCTGCAGCCTGGCC -3'
(R):5'- GACCCTAAGTGACCAATTACTTAAAG -3'
Posted On2015-02-05