Incidental Mutation 'R1756:Taf4'
ID266210
Institutional Source Beutler Lab
Gene Symbol Taf4
Ensembl Gene ENSMUSG00000039117
Gene NameTATA-box binding protein associated factor 4
SynonymsTaf4a, Taf2c1, TAFII130, TAFII135
MMRRC Submission 039788-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1756 (G1)
Quality Score20.1
Status Validated
Chromosome2
Chromosomal Location179912152-179976646 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 179976531 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 39 (H39R)
Ref Sequence ENSEMBL: ENSMUSP00000153863 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041618] [ENSMUST00000227325]
Predicted Effect unknown
Transcript: ENSMUST00000041618
AA Change: H39R
SMART Domains Protein: ENSMUSP00000038610
Gene: ENSMUSG00000039117
AA Change: H39R

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
low complexity region 64 181 N/A INTRINSIC
SCOP:d1hqva_ 312 325 6e-3 SMART
low complexity region 339 371 N/A INTRINSIC
low complexity region 395 408 N/A INTRINSIC
low complexity region 428 443 N/A INTRINSIC
low complexity region 445 458 N/A INTRINSIC
internal_repeat_1 465 500 2.85e-5 PROSPERO
low complexity region 537 547 N/A INTRINSIC
TAFH 550 642 4.9e-54 SMART
internal_repeat_1 692 727 2.85e-5 PROSPERO
low complexity region 767 773 N/A INTRINSIC
Pfam:TAF4 791 1039 3.5e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153188
Predicted Effect unknown
Transcript: ENSMUST00000227325
AA Change: H39R
Meta Mutation Damage Score 0.224 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency 100% (96/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the larger subunits of TFIID that has been shown to potentiate transcriptional activation by retinoic acid, thyroid hormone and vitamin D3 receptors. In addition, this subunit interacts with the transcription factor CREB, which has a glutamine-rich activation domain, and binds to other proteins containing glutamine-rich regions. Aberrant binding to this subunit by proteins with expanded polyglutamine regions has been suggested as one of the pathogenetic mechanisms underlying a group of neurodegenerative disorders referred to as polyglutamine diseases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for deletions of this marker die embryonically sometime around E9.5. Conditional expression of this allele in the epidermis causes skin barrier defects and defects in hair growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T A 13: 63,068,061 H382Q possibly damaging Het
A330008L17Rik C A 8: 99,421,882 noncoding transcript Het
Acin1 A G 14: 54,665,204 V377A probably benign Het
Adam39 A T 8: 40,825,324 I251F probably damaging Het
Adnp2 A T 18: 80,127,697 *1166K probably null Het
Akap12 T A 10: 4,357,574 D1461E probably benign Het
Apba1 A G 19: 23,893,692 D296G possibly damaging Het
Apol7a G T 15: 77,393,471 L26M possibly damaging Het
Bcl2 C T 1: 106,712,392 M163I probably damaging Het
Cap2 T G 13: 46,531,013 I53R probably benign Het
Ccdc105 T A 10: 78,747,197 K451M probably damaging Het
Ccdc74a T C 16: 17,650,468 V318A possibly damaging Het
Ccnb2 A G 9: 70,410,788 V234A probably benign Het
Cd207 C T 6: 83,675,597 V184I probably benign Het
Cdk12 C A 11: 98,241,761 C1005* probably null Het
Cep83 T C 10: 94,750,267 S344P probably damaging Het
Ces1g A T 8: 93,306,954 Y447N probably benign Het
Cfap54 A T 10: 93,048,061 L277Q probably damaging Het
Cfh A G 1: 140,100,877 Y1027H probably damaging Het
Clcnkb T A 4: 141,415,214 I28F possibly damaging Het
Clec4d A G 6: 123,267,109 D59G probably damaging Het
Colq G A 14: 31,547,452 P153S probably damaging Het
Crybg1 T A 10: 43,986,279 T1500S probably damaging Het
Cyp2d34 T A 15: 82,617,524 R262W probably damaging Het
Dennd4b C G 3: 90,271,605 L559V probably damaging Het
Dhrs1 A G 14: 55,739,309 V306A probably benign Het
Diaph1 A T 18: 37,854,573 D1043E possibly damaging Het
Dis3 G T 14: 99,086,103 D538E probably damaging Het
Dnaic2 T G 11: 114,750,380 S344A probably benign Het
Dner C T 1: 84,445,590 V431M probably damaging Het
Dnm1l A G 16: 16,342,695 probably null Het
Eps15 T G 4: 109,312,918 L139* probably null Het
Fam193a T A 5: 34,466,292 I55N possibly damaging Het
Gm10308 T A 17: 91,088,957 Y102* probably null Het
Gm10509 A G 17: 21,690,855 K30E possibly damaging Het
Gm4778 A T 3: 94,266,218 M174L probably benign Het
Gm9573 A T 17: 35,619,239 probably benign Het
Gpr155 T C 2: 73,367,577 M400V probably benign Het
H2-M10.2 T C 17: 36,286,123 probably benign Het
Heatr1 G T 13: 12,396,460 A61S probably benign Het
Helb G T 10: 120,094,242 T744K probably damaging Het
Hmcn1 C A 1: 150,599,030 W4702L probably damaging Het
Hmcn2 C T 2: 31,396,120 R2095W probably damaging Het
Igfbp3 G C 11: 7,208,461 D267E probably damaging Het
Ighmbp2 T A 19: 3,268,669 H469L probably damaging Het
Kcnj3 A C 2: 55,437,220 K7T probably damaging Het
Krtap5-5 T G 7: 142,229,621 K97N unknown Het
Lcor T C 19: 41,559,266 S430P probably benign Het
Lpin1 A G 12: 16,538,540 V883A probably damaging Het
Lrp1b T C 2: 41,110,825 Y2243C probably damaging Het
Lrrc46 G A 11: 97,034,730 probably benign Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mpdz C T 4: 81,306,877 V1438M possibly damaging Het
Ncbp1 T A 4: 46,169,131 L635* probably null Het
Nipbl T C 15: 8,338,551 N1202D possibly damaging Het
Nphs1 A G 7: 30,461,534 D196G probably benign Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr1008 A G 2: 85,690,083 Y218C probably damaging Het
Olfr1360 A G 13: 21,674,695 I83T probably benign Het
Olfr901 A T 9: 38,430,995 I238F probably benign Het
Pax8 A T 2: 24,435,821 N350K probably damaging Het
Pik3cd T C 4: 149,658,750 K298E probably benign Het
Pkd1 C T 17: 24,594,485 R4000C probably damaging Het
Pkn2 A T 3: 142,810,727 V546D possibly damaging Het
Plcg2 A G 8: 117,592,708 K673E probably benign Het
Pld4 T G 12: 112,763,392 probably null Het
Plek A T 11: 16,992,901 N130K probably damaging Het
Prune2 G A 19: 17,123,704 D2191N probably benign Het
Ptgis T C 2: 167,206,803 Y431C probably damaging Het
Rhbdf2 T C 11: 116,607,266 S36G probably benign Het
Rtn4ip1 C T 10: 43,910,830 A178V probably damaging Het
Rxfp1 A G 3: 79,670,881 S168P probably benign Het
Sec24a A G 11: 51,733,763 probably benign Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Slitrk6 C T 14: 110,750,552 M574I probably benign Het
Slk T C 19: 47,622,677 F861L probably damaging Het
Smpd3 C A 8: 106,264,971 A317S probably benign Het
Spz1 T A 13: 92,575,125 Q281L probably damaging Het
Syde1 T A 10: 78,586,980 R519S probably benign Het
Tbx5 A T 5: 119,845,113 probably null Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Th G A 7: 142,898,166 Q19* probably null Het
Tmprss11a T A 5: 86,420,179 I230F probably damaging Het
Tnfrsf14 T A 4: 154,925,322 H50L possibly damaging Het
Tpp2 T A 1: 43,978,725 probably null Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim2 A G 3: 84,190,800 I398T possibly damaging Het
Trpc5 A T X: 144,481,226 S212T probably damaging Het
Ttn A G 2: 76,787,334 probably benign Het
Unc80 A G 1: 66,639,248 T2063A possibly damaging Het
Usp37 A T 1: 74,479,655 S260T probably benign Het
Vcan A G 13: 89,691,681 S1915P probably benign Het
Vmn1r33 T A 6: 66,612,298 I91F possibly damaging Het
Zfp422 T C 6: 116,626,424 T205A probably benign Het
Other mutations in Taf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Taf4 APN 2 179976625 missense unknown
IGL00517:Taf4 APN 2 179924413 splice site probably benign
IGL02159:Taf4 APN 2 179938470 missense probably benign 0.24
IGL02254:Taf4 APN 2 179921184 missense probably benign 0.25
IGL03366:Taf4 APN 2 179935054 missense probably damaging 1.00
R0049:Taf4 UTSW 2 179924091 missense probably damaging 0.98
R0049:Taf4 UTSW 2 179924091 missense probably damaging 0.98
R1267:Taf4 UTSW 2 179929324 missense possibly damaging 0.46
R1495:Taf4 UTSW 2 179933027 missense probably damaging 1.00
R1560:Taf4 UTSW 2 179935953 missense probably benign 0.14
R1893:Taf4 UTSW 2 179933030 missense probably damaging 0.98
R1932:Taf4 UTSW 2 179932029 missense probably damaging 1.00
R2213:Taf4 UTSW 2 179935890 critical splice donor site probably null
R3896:Taf4 UTSW 2 179932014 missense probably benign 0.45
R4050:Taf4 UTSW 2 179932012 missense probably damaging 1.00
R4448:Taf4 UTSW 2 179935971 missense possibly damaging 0.65
R4736:Taf4 UTSW 2 179924494 missense probably damaging 1.00
R5124:Taf4 UTSW 2 179932029 missense probably damaging 1.00
R6155:Taf4 UTSW 2 179913524 missense probably damaging 1.00
R6238:Taf4 UTSW 2 179932039 missense probably damaging 0.97
R6292:Taf4 UTSW 2 179923987 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCGCTCCCATTCAAAGTTTGC -3'
(R):5'- CAGCCATTGGCCGCGTCTTTTA -3'

Sequencing Primer
(F):5'- cTGCGGGGACAAGCAAG -3'
(R):5'- cccgcTGGAACCTCCTC -3'
Posted On2015-02-06