Incidental Mutation 'R3432:Arsj'
ID266227
Institutional Source Beutler Lab
Gene Symbol Arsj
Ensembl Gene ENSMUSG00000046561
Gene Namearylsulfatase J
Synonyms9330196J05Rik
MMRRC Submission 040650-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R3432 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location126363684-126440375 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 126364975 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 68 (T68S)
Ref Sequence ENSEMBL: ENSMUSP00000091511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093976]
Predicted Effect probably benign
Transcript: ENSMUST00000093976
AA Change: T68S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000091511
Gene: ENSMUSG00000046561
AA Change: T68S

DomainStartEndE-ValueType
Pfam:Sulfatase 74 388 8.4e-68 PFAM
low complexity region 554 582 N/A INTRINSIC
Meta Mutation Damage Score 0.042 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfatases (EC 3.1.5.6), such as ARSJ, hydrolyze sulfate esters from sulfated steroids, carbohydrates, proteoglycans, and glycolipids. They are involved in hormone biosynthesis, modulation of cell signaling, and degradation of macromolecules (Sardiello et al., 2005 [PubMed 16174644]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr3 G A 1: 125,394,039 P405S probably damaging Het
Adamts3 A G 5: 89,707,453 probably benign Het
Angptl2 T C 2: 33,228,802 V196A probably benign Het
Aoc1 A T 6: 48,905,844 H240L probably damaging Het
Atp8b3 T C 10: 80,526,180 K708E probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Ceacam5 T A 7: 17,714,976 V89E probably benign Het
Cpt1b T C 15: 89,423,741 E205G possibly damaging Het
Dhrs7c C T 11: 67,809,873 T82I probably benign Het
Efs C T 14: 54,920,224 R117Q probably damaging Het
Evl T C 12: 108,648,308 probably benign Het
Fam89b A T 19: 5,731,733 probably null Het
Fbxo16 T C 14: 65,293,784 F46L probably damaging Het
Glp1r T A 17: 30,924,557 L189H probably damaging Het
Gstp1 G A 19: 4,036,695 T110I possibly damaging Het
Hbq1a T G 11: 32,300,715 S133A probably benign Het
Hhipl1 A G 12: 108,311,689 E92G probably damaging Het
Il18r1 C T 1: 40,487,089 T265M probably damaging Het
Lpp T C 16: 24,889,886 V447A probably benign Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mmel1 C T 4: 154,885,498 probably benign Het
Myo5c A G 9: 75,263,001 E471G probably damaging Het
Obscn A G 11: 59,031,177 L317P probably damaging Het
Olfr983 A T 9: 40,092,549 M139K probably damaging Het
Psg18 A G 7: 18,349,171 V232A possibly damaging Het
Ptprt T C 2: 161,927,529 E472G probably damaging Het
Rap2a G T 14: 120,503,758 A158S possibly damaging Het
Rbm15 A T 3: 107,330,677 S802T probably benign Het
Sec14l5 A G 16: 5,178,599 I470V possibly damaging Het
Serpinb1a T C 13: 32,842,859 T367A possibly damaging Het
Sirpb1a A G 3: 15,426,387 W7R probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Taf5 A C 19: 47,075,833 K405T probably damaging Het
Tbc1d19 T C 5: 53,848,206 probably benign Het
Trim58 T C 11: 58,646,961 probably benign Het
Tssk4 A G 14: 55,651,695 N226S probably damaging Het
Uggt1 C A 1: 36,210,059 E267* probably null Het
Zdhhc23 T A 16: 43,974,170 probably benign Het
Zfp407 G A 18: 84,208,746 A2246V probably damaging Het
Zfp872 C T 9: 22,200,454 R410* probably null Het
Other mutations in Arsj
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Arsj APN 3 126364945 missense probably benign 0.00
IGL01150:Arsj APN 3 126438784 missense probably benign
IGL01337:Arsj APN 3 126365114 missense probably damaging 1.00
IGL01446:Arsj APN 3 126438814 missense probably benign 0.01
IGL01484:Arsj APN 3 126365036 missense probably damaging 1.00
IGL02479:Arsj APN 3 126438939 missense possibly damaging 0.91
IGL03149:Arsj APN 3 126439404 utr 3 prime probably benign
R0552:Arsj UTSW 3 126439344 missense probably benign 0.01
R0690:Arsj UTSW 3 126438184 missense probably damaging 0.99
R1809:Arsj UTSW 3 126438295 missense possibly damaging 0.87
R1881:Arsj UTSW 3 126438837 missense probably damaging 1.00
R1940:Arsj UTSW 3 126438346 missense probably damaging 1.00
R1957:Arsj UTSW 3 126439021 missense probably benign 0.08
R2156:Arsj UTSW 3 126438688 missense probably damaging 1.00
R2969:Arsj UTSW 3 126439372 missense probably benign 0.01
R4623:Arsj UTSW 3 126364796 missense probably benign 0.00
R4826:Arsj UTSW 3 126438802 missense probably damaging 1.00
R4955:Arsj UTSW 3 126438540 missense probably benign 0.15
R5134:Arsj UTSW 3 126438154 missense probably benign
R5164:Arsj UTSW 3 126438159 missense probably benign 0.00
R5468:Arsj UTSW 3 126438388 missense possibly damaging 0.52
R5664:Arsj UTSW 3 126438657 missense probably damaging 1.00
R6136:Arsj UTSW 3 126364775 start codon destroyed probably null 0.07
X0022:Arsj UTSW 3 126364966 missense possibly damaging 0.52
Z1088:Arsj UTSW 3 126439132 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CTGTGGGACCAGAGTGAATG -3'
(R):5'- GTAATAAACTGGCTCCTGGACGG -3'

Sequencing Primer
(F):5'- ACCAGAGTGAATGGCCCC -3'
(R):5'- CTCCTGGACGGTGTGCAAATAG -3'
Posted On2015-02-18