Incidental Mutation 'R3432:Hhipl1'
ID266247
Institutional Source Beutler Lab
Gene Symbol Hhipl1
Ensembl Gene ENSMUSG00000021260
Gene Namehedgehog interacting protein-like 1
Synonyms
MMRRC Submission 040650-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3432 (G1)
Quality Score220
Status Validated
Chromosome12
Chromosomal Location108306270-108330869 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108311689 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 92 (E92G)
Ref Sequence ENSEMBL: ENSMUSP00000021685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021685]
Predicted Effect probably damaging
Transcript: ENSMUST00000021685
AA Change: E92G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021685
Gene: ENSMUSG00000021260
AA Change: E92G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Folate_rec 28 189 2.4e-21 PFAM
Pfam:GSDH 199 532 3e-39 PFAM
low complexity region 619 670 N/A INTRINSIC
SR 682 785 2.01e-47 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223395
Meta Mutation Damage Score 0.362 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the glucose/sorbosone dehydrogenase family. The encoded protein also contains a domain that binds folate and reduced folic acid derivatives. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr3 G A 1: 125,394,039 P405S probably damaging Het
Adamts3 A G 5: 89,707,453 probably benign Het
Angptl2 T C 2: 33,228,802 V196A probably benign Het
Aoc1 A T 6: 48,905,844 H240L probably damaging Het
Arsj A T 3: 126,364,975 T68S probably benign Het
Atp8b3 T C 10: 80,526,180 K708E probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Ceacam5 T A 7: 17,714,976 V89E probably benign Het
Cpt1b T C 15: 89,423,741 E205G possibly damaging Het
Dhrs7c C T 11: 67,809,873 T82I probably benign Het
Efs C T 14: 54,920,224 R117Q probably damaging Het
Evl T C 12: 108,648,308 probably benign Het
Fam89b A T 19: 5,731,733 probably null Het
Fbxo16 T C 14: 65,293,784 F46L probably damaging Het
Glp1r T A 17: 30,924,557 L189H probably damaging Het
Gstp1 G A 19: 4,036,695 T110I possibly damaging Het
Hbq1a T G 11: 32,300,715 S133A probably benign Het
Il18r1 C T 1: 40,487,089 T265M probably damaging Het
Lpp T C 16: 24,889,886 V447A probably benign Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mmel1 C T 4: 154,885,498 probably benign Het
Myo5c A G 9: 75,263,001 E471G probably damaging Het
Obscn A G 11: 59,031,177 L317P probably damaging Het
Olfr983 A T 9: 40,092,549 M139K probably damaging Het
Psg18 A G 7: 18,349,171 V232A possibly damaging Het
Ptprt T C 2: 161,927,529 E472G probably damaging Het
Rap2a G T 14: 120,503,758 A158S possibly damaging Het
Rbm15 A T 3: 107,330,677 S802T probably benign Het
Sec14l5 A G 16: 5,178,599 I470V possibly damaging Het
Serpinb1a T C 13: 32,842,859 T367A possibly damaging Het
Sirpb1a A G 3: 15,426,387 W7R probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Taf5 A C 19: 47,075,833 K405T probably damaging Het
Tbc1d19 T C 5: 53,848,206 probably benign Het
Trim58 T C 11: 58,646,961 probably benign Het
Tssk4 A G 14: 55,651,695 N226S probably damaging Het
Uggt1 C A 1: 36,210,059 E267* probably null Het
Zdhhc23 T A 16: 43,974,170 probably benign Het
Zfp407 G A 18: 84,208,746 A2246V probably damaging Het
Zfp872 C T 9: 22,200,454 R410* probably null Het
Other mutations in Hhipl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
lemon_drops UTSW 12 108311944 missense probably damaging 1.00
rock_candy UTSW 12 108311689 missense probably damaging 1.00
R0091:Hhipl1 UTSW 12 108321897 splice site probably benign
R0180:Hhipl1 UTSW 12 108328070 missense probably damaging 1.00
R0610:Hhipl1 UTSW 12 108319402 nonsense probably null
R0962:Hhipl1 UTSW 12 108327721 missense probably benign 0.02
R1170:Hhipl1 UTSW 12 108311693 nonsense probably null
R1474:Hhipl1 UTSW 12 108311737 missense probably damaging 1.00
R1878:Hhipl1 UTSW 12 108320060 missense possibly damaging 0.93
R2001:Hhipl1 UTSW 12 108321859 missense possibly damaging 0.90
R2103:Hhipl1 UTSW 12 108327718 missense probably benign 0.04
R2132:Hhipl1 UTSW 12 108311690 missense probably damaging 1.00
R2342:Hhipl1 UTSW 12 108318462 missense probably damaging 1.00
R2408:Hhipl1 UTSW 12 108318547 missense probably benign 0.05
R3431:Hhipl1 UTSW 12 108311689 missense probably damaging 1.00
R3741:Hhipl1 UTSW 12 108318717 missense probably damaging 1.00
R3802:Hhipl1 UTSW 12 108312307 missense probably benign
R4744:Hhipl1 UTSW 12 108319979 missense possibly damaging 0.95
R4760:Hhipl1 UTSW 12 108320077 missense probably damaging 0.99
R4927:Hhipl1 UTSW 12 108311944 missense probably damaging 1.00
R5206:Hhipl1 UTSW 12 108312178 missense probably damaging 1.00
R5244:Hhipl1 UTSW 12 108312134 missense probably damaging 0.99
R5292:Hhipl1 UTSW 12 108327778 missense probably benign
R5445:Hhipl1 UTSW 12 108328208 missense probably damaging 0.97
R6248:Hhipl1 UTSW 12 108318705 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGGTAAACTGTGCCCTGCC -3'
(R):5'- GGCATAATTTGGCCCGGTTG -3'

Sequencing Primer
(F):5'- AAGACCAAAGCTTCTTGCCTTG -3'
(R):5'- ATAATTTGGCCCGGTTGCTCTC -3'
Posted On2015-02-18