Incidental Mutation 'R3432:Taf5'
ID266265
Institutional Source Beutler Lab
Gene Symbol Taf5
Ensembl Gene ENSMUSG00000025049
Gene NameTATA-box binding protein associated factor 5
Synonyms6330528C20Rik
MMRRC Submission 040650-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R3432 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location47067748-47083479 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 47075833 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 405 (K405T)
Ref Sequence ENSEMBL: ENSMUSP00000026027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026027]
Predicted Effect probably damaging
Transcript: ENSMUST00000026027
AA Change: K405T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026027
Gene: ENSMUSG00000025049
AA Change: K405T

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 29 92 N/A INTRINSIC
LisH 93 125 6.52e-2 SMART
low complexity region 132 150 N/A INTRINSIC
Pfam:TFIID_NTD2 206 338 4.5e-55 PFAM
low complexity region 389 417 N/A INTRINSIC
WD40 460 499 8.36e-2 SMART
WD40 533 572 1.82e-11 SMART
WD40 575 614 1.19e-6 SMART
WD40 617 656 9.08e-12 SMART
WD40 659 698 1.4e-12 SMART
WD40 701 740 2.57e-11 SMART
Meta Mutation Damage Score 0.25 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes an integral subunit of TFIID associated with all transcriptionally competent forms of that complex. This subunit interacts strongly with two TFIID subunits that show similarity to histones H3 and H4, and it may participate in forming a nucleosome-like core in the TFIID complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr3 G A 1: 125,394,039 P405S probably damaging Het
Adamts3 A G 5: 89,707,453 probably benign Het
Angptl2 T C 2: 33,228,802 V196A probably benign Het
Aoc1 A T 6: 48,905,844 H240L probably damaging Het
Arsj A T 3: 126,364,975 T68S probably benign Het
Atp8b3 T C 10: 80,526,180 K708E probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Ceacam5 T A 7: 17,714,976 V89E probably benign Het
Cpt1b T C 15: 89,423,741 E205G possibly damaging Het
Dhrs7c C T 11: 67,809,873 T82I probably benign Het
Efs C T 14: 54,920,224 R117Q probably damaging Het
Evl T C 12: 108,648,308 probably benign Het
Fam89b A T 19: 5,731,733 probably null Het
Fbxo16 T C 14: 65,293,784 F46L probably damaging Het
Glp1r T A 17: 30,924,557 L189H probably damaging Het
Gstp1 G A 19: 4,036,695 T110I possibly damaging Het
Hbq1a T G 11: 32,300,715 S133A probably benign Het
Hhipl1 A G 12: 108,311,689 E92G probably damaging Het
Il18r1 C T 1: 40,487,089 T265M probably damaging Het
Lpp T C 16: 24,889,886 V447A probably benign Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mmel1 C T 4: 154,885,498 probably benign Het
Myo5c A G 9: 75,263,001 E471G probably damaging Het
Obscn A G 11: 59,031,177 L317P probably damaging Het
Olfr983 A T 9: 40,092,549 M139K probably damaging Het
Psg18 A G 7: 18,349,171 V232A possibly damaging Het
Ptprt T C 2: 161,927,529 E472G probably damaging Het
Rap2a G T 14: 120,503,758 A158S possibly damaging Het
Rbm15 A T 3: 107,330,677 S802T probably benign Het
Sec14l5 A G 16: 5,178,599 I470V possibly damaging Het
Serpinb1a T C 13: 32,842,859 T367A possibly damaging Het
Sirpb1a A G 3: 15,426,387 W7R probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Tbc1d19 T C 5: 53,848,206 probably benign Het
Trim58 T C 11: 58,646,961 probably benign Het
Tssk4 A G 14: 55,651,695 N226S probably damaging Het
Uggt1 C A 1: 36,210,059 E267* probably null Het
Zdhhc23 T A 16: 43,974,170 probably benign Het
Zfp407 G A 18: 84,208,746 A2246V probably damaging Het
Zfp872 C T 9: 22,200,454 R410* probably null Het
Other mutations in Taf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Taf5 APN 19 47082301 missense probably damaging 1.00
IGL01115:Taf5 APN 19 47075082 missense probably benign 0.01
IGL02168:Taf5 APN 19 47082478 missense probably damaging 0.98
IGL02638:Taf5 APN 19 47068210 missense probably benign 0.00
IGL02689:Taf5 APN 19 47077265 splice site probably benign
R0008:Taf5 UTSW 19 47075862 missense possibly damaging 0.94
R0008:Taf5 UTSW 19 47075862 missense possibly damaging 0.94
R0220:Taf5 UTSW 19 47080560 missense probably damaging 1.00
R0685:Taf5 UTSW 19 47074854 missense probably benign 0.10
R1518:Taf5 UTSW 19 47081846 missense probably damaging 1.00
R2329:Taf5 UTSW 19 47075124 missense probably benign 0.07
R3431:Taf5 UTSW 19 47075833 missense probably damaging 1.00
R3689:Taf5 UTSW 19 47078785 missense probably damaging 0.99
R4411:Taf5 UTSW 19 47071014 missense probably damaging 1.00
R4413:Taf5 UTSW 19 47071014 missense probably damaging 1.00
R4676:Taf5 UTSW 19 47074970 missense probably damaging 1.00
R5370:Taf5 UTSW 19 47075764 missense probably damaging 0.99
R5875:Taf5 UTSW 19 47076110 missense probably damaging 1.00
R5883:Taf5 UTSW 19 47067789 missense unknown
R5937:Taf5 UTSW 19 47081895 missense probably damaging 1.00
R6835:Taf5 UTSW 19 47077337 missense possibly damaging 0.94
R7007:Taf5 UTSW 19 47071211 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTAGCTGCAAGAGAGCCTG -3'
(R):5'- CGCACTCGTTTGGTAGTTTC -3'

Sequencing Primer
(F):5'- GCCTGAAAAGAGAAATGACCTAAC -3'
(R):5'- TGTCTGAATCTTTTAACTCAGGAAG -3'
Posted On2015-02-18