Incidental Mutation 'R3433:Tnks1bp1'
ID266272
Institutional Source Beutler Lab
Gene Symbol Tnks1bp1
Ensembl Gene ENSMUSG00000033955
Gene Nametankyrase 1 binding protein 1
SynonymsTAB182
MMRRC Submission 040651-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3433 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location85048022-85073048 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 85071016 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048400] [ENSMUST00000111605]
Predicted Effect probably benign
Transcript: ENSMUST00000048400
SMART Domains Protein: ENSMUSP00000045767
Gene: ENSMUSG00000033955

DomainStartEndE-ValueType
low complexity region 77 96 N/A INTRINSIC
low complexity region 292 298 N/A INTRINSIC
low complexity region 809 827 N/A INTRINSIC
low complexity region 868 875 N/A INTRINSIC
Tankyrase_bdg_C 883 1055 1.98e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111605
SMART Domains Protein: ENSMUSP00000107232
Gene: ENSMUSG00000033955

DomainStartEndE-ValueType
low complexity region 37 44 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
low complexity region 296 316 N/A INTRINSIC
low complexity region 380 391 N/A INTRINSIC
low complexity region 496 518 N/A INTRINSIC
low complexity region 739 758 N/A INTRINSIC
low complexity region 954 960 N/A INTRINSIC
low complexity region 1471 1489 N/A INTRINSIC
low complexity region 1530 1537 N/A INTRINSIC
Tankyrase_bdg_C 1545 1717 1.98e-79 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126309
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135659
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151092
Meta Mutation Damage Score 0.0708 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T A 7: 120,294,232 W1302R probably damaging Het
Abcf1 A G 17: 35,958,217 Y689H probably benign Het
Adamtsl5 T C 10: 80,342,891 T218A probably benign Het
Ahnak G T 19: 9,009,994 V2881L probably benign Het
Atp6v1b1 C A 6: 83,743,092 T3K possibly damaging Het
Atp8b5 A T 4: 43,372,697 R1112S probably benign Het
Carmil3 A G 14: 55,507,694 D1331G probably benign Het
Catsperg2 A G 7: 29,701,218 F696S possibly damaging Het
Cd33 T C 7: 43,529,907 T273A probably benign Het
Cenpf C T 1: 189,659,949 C562Y probably damaging Het
Cep192 A G 18: 67,834,892 R816G probably benign Het
Cnot11 G A 1: 39,545,187 probably null Het
Col18a1 A G 10: 77,096,268 L329P unknown Het
Dnah9 T C 11: 66,075,112 M1693V possibly damaging Het
Fbxo41 A G 6: 85,477,631 I701T probably damaging Het
Figla G T 6: 86,017,429 R62L probably damaging Het
Gca T G 2: 62,689,974 S159R probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm10845 C T 14: 79,863,411 noncoding transcript Het
Gm5114 T C 7: 39,409,197 K333E probably benign Het
Ift140 T C 17: 25,036,308 I466T probably benign Het
Il6st A G 13: 112,503,831 K653E probably damaging Het
Kansl2 A G 15: 98,528,861 probably null Het
Kcnh7 T C 2: 62,721,917 D910G probably benign Het
Leng8 C A 7: 4,142,132 T177K probably benign Het
Lrrtm2 A C 18: 35,213,897 S117R probably damaging Het
Megf8 G T 7: 25,360,124 A2285S probably benign Het
Meiob T C 17: 24,816,597 probably benign Het
Myo18a G T 11: 77,818,044 probably null Het
Nars A T 18: 64,509,303 M156K probably damaging Het
Ndor1 A G 2: 25,247,811 S499P possibly damaging Het
Olfr1251 T C 2: 89,667,233 I218V probably benign Het
Olfr458 G A 6: 42,460,954 H22Y probably benign Het
Olfr47 A T 6: 43,235,673 I22F probably damaging Het
Pcdh15 T G 10: 74,631,499 S1715A probably benign Het
Ptprd C A 4: 76,086,011 probably null Het
Ros1 A G 10: 52,091,108 Y1668H probably benign Het
Rrbp1 A G 2: 143,952,280 probably benign Het
Rtn4rl2 T C 2: 84,872,100 Y376C probably damaging Het
Seh1l A C 18: 67,793,152 K358T probably benign Het
Sema3e A T 5: 14,252,714 Y751F probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Spred2 G T 11: 19,998,277 E91* probably null Het
Sspo A T 6: 48,475,951 probably null Het
Tcaf1 A G 6: 42,686,574 V124A probably damaging Het
Txndc11 T C 16: 11,088,188 T493A probably benign Het
Usp17lb T A 7: 104,841,648 Q23L possibly damaging Het
Vgf T C 5: 137,031,019 F12L probably benign Het
Zfp13 G A 17: 23,576,628 T323I probably damaging Het
Other mutations in Tnks1bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Tnks1bp1 APN 2 85062236 nonsense probably null
IGL00974:Tnks1bp1 APN 2 85062882 missense possibly damaging 0.92
IGL01874:Tnks1bp1 APN 2 85058447 missense probably benign 0.01
IGL02419:Tnks1bp1 APN 2 85071781 missense possibly damaging 0.60
IGL02441:Tnks1bp1 APN 2 85071799 missense probably damaging 1.00
IGL02475:Tnks1bp1 APN 2 85059377 missense probably damaging 1.00
IGL03181:Tnks1bp1 APN 2 85062714 missense probably benign 0.00
K3955:Tnks1bp1 UTSW 2 85062411 missense probably benign 0.01
P0038:Tnks1bp1 UTSW 2 85062411 missense probably benign 0.01
PIT4791001:Tnks1bp1 UTSW 2 85062558 missense probably benign 0.03
R0068:Tnks1bp1 UTSW 2 85062352 missense probably benign 0.12
R0068:Tnks1bp1 UTSW 2 85062352 missense probably benign 0.12
R0164:Tnks1bp1 UTSW 2 85059221 missense possibly damaging 0.94
R0164:Tnks1bp1 UTSW 2 85059221 missense possibly damaging 0.94
R0189:Tnks1bp1 UTSW 2 85070929 missense possibly damaging 0.77
R0454:Tnks1bp1 UTSW 2 85072137 missense probably damaging 1.00
R0650:Tnks1bp1 UTSW 2 85062630 missense possibly damaging 0.68
R0737:Tnks1bp1 UTSW 2 85052536 missense possibly damaging 0.93
R1718:Tnks1bp1 UTSW 2 85071738 missense probably benign 0.44
R1749:Tnks1bp1 UTSW 2 85063067 missense probably benign
R2194:Tnks1bp1 UTSW 2 85063065 missense probably benign 0.06
R2314:Tnks1bp1 UTSW 2 85058915 missense probably benign 0.01
R2379:Tnks1bp1 UTSW 2 85063838 missense probably benign 0.16
R3056:Tnks1bp1 UTSW 2 85070000 nonsense probably null
R3751:Tnks1bp1 UTSW 2 85058722 start gained probably benign
R4502:Tnks1bp1 UTSW 2 85062647 nonsense probably null
R4694:Tnks1bp1 UTSW 2 85071722 missense probably damaging 1.00
R4785:Tnks1bp1 UTSW 2 85063034 missense probably damaging 1.00
R5079:Tnks1bp1 UTSW 2 85062626 missense probably damaging 1.00
R5208:Tnks1bp1 UTSW 2 85070632 missense probably damaging 0.96
R5265:Tnks1bp1 UTSW 2 85062754 missense probably benign 0.01
R5512:Tnks1bp1 UTSW 2 85062834 missense probably benign 0.00
R5557:Tnks1bp1 UTSW 2 85063800 missense probably damaging 0.97
R6016:Tnks1bp1 UTSW 2 85052390 missense probably damaging 1.00
R6177:Tnks1bp1 UTSW 2 85059280 start gained probably benign
R6516:Tnks1bp1 UTSW 2 85070727 missense probably damaging 0.97
R6517:Tnks1bp1 UTSW 2 85059345 missense probably benign 0.00
R7032:Tnks1bp1 UTSW 2 85061953 missense probably benign 0.00
R7120:Tnks1bp1 UTSW 2 85072097 missense probably damaging 1.00
R7302:Tnks1bp1 UTSW 2 85052354 missense probably benign 0.24
R7393:Tnks1bp1 UTSW 2 85062866 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTGGCATGTTGCTCAGGTC -3'
(R):5'- GGCCCTGAGATGAAAGAACACC -3'

Sequencing Primer
(F):5'- GCTCAGGTCTCGATTCACG -3'
(R):5'- TTCCATCAAACTTGGCACACTG -3'
Posted On2015-02-18