Incidental Mutation 'R3434:Olfr1200'
ID266329
Institutional Source Beutler Lab
Gene Symbol Olfr1200
Ensembl Gene ENSMUSG00000075115
Gene Nameolfactory receptor 1200
SynonymsMOR225-12, GA_x6K02T2Q125-50243231-50242221
MMRRC Submission 040652-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R3434 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location88763511-88770488 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88768069 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 82 (D82G)
Ref Sequence ENSEMBL: ENSMUSP00000149757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099811] [ENSMUST00000217588]
Predicted Effect probably damaging
Transcript: ENSMUST00000099811
AA Change: D82G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097399
Gene: ENSMUSG00000075115
AA Change: D82G

DomainStartEndE-ValueType
Pfam:7tm_4 29 302 3.2e-47 PFAM
Pfam:7tm_1 39 285 2.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217588
AA Change: D82G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.242 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G A 17: 24,289,537 A1008V probably damaging Het
Adora3 A G 3: 105,904,915 K39R probably benign Het
Ankib1 A G 5: 3,692,760 V1085A probably damaging Het
Atp7a G A X: 106,094,857 R563K probably benign Het
Azin1 T C 15: 38,493,576 I268V probably benign Het
Carm1 T C 9: 21,569,473 F81S probably damaging Het
Ccnjl A G 11: 43,579,861 Y152C probably damaging Het
Chrna3 T A 9: 55,024,326 I61F possibly damaging Het
Clca3a2 G A 3: 144,808,761 probably benign Het
Clstn2 T A 9: 97,454,715 D903V probably benign Het
Dpysl3 C T 18: 43,361,061 V70I probably benign Het
Drg2 A T 11: 60,461,392 K180* probably null Het
Dync2h1 A C 9: 7,011,236 H3659Q probably benign Het
Dysf A T 6: 84,070,888 Y349F probably benign Het
Epb41l4b T C 4: 57,040,865 N533D probably benign Het
Fam47e T A 5: 92,585,362 V152D probably damaging Het
Fasn G A 11: 120,822,773 A24V probably damaging Het
Fhl4 T C 10: 85,098,444 T158A probably benign Het
Fnbp1l C T 3: 122,546,306 R499Q probably damaging Het
Hdlbp A T 1: 93,428,161 M358K probably benign Het
Ift74 A G 4: 94,621,852 probably null Het
Lhx4 A G 1: 155,702,401 Y332H probably damaging Het
Mast2 A T 4: 116,308,095 S1314T probably benign Het
Mast4 A G 13: 102,787,379 I508T probably damaging Het
Mdn1 T C 4: 32,733,726 probably null Het
Mrps23 A G 11: 88,210,114 K44E probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mup6 G T 4: 60,004,116 probably null Het
Notch3 A T 17: 32,158,618 D161E possibly damaging Het
Olfr1131 T C 2: 87,629,074 F204L probably benign Het
Olfr695 A T 7: 106,873,769 Y159N probably benign Het
P2rx4 T A 5: 122,725,070 I202K probably damaging Het
Phykpl A G 11: 51,598,655 T363A probably benign Het
Pitpnm1 G A 19: 4,112,234 A1047T probably damaging Het
Ppat A G 5: 76,918,065 I402T probably damaging Het
Rpgr A G X: 10,176,602 S656P probably benign Het
Rsbn1l T C 5: 20,905,930 probably benign Het
Sacs A G 14: 61,212,303 K3933E probably damaging Het
Scn7a T C 2: 66,675,503 I1681V probably benign Het
Sel1l3 T C 5: 53,117,090 D1016G probably benign Het
Sf3a3 C A 4: 124,725,077 T277N possibly damaging Het
Slc35a5 A G 16: 45,144,033 I279T probably benign Het
Slc39a10 T C 1: 46,835,717 T142A probably benign Het
Tle3 T A 9: 61,414,094 probably null Het
Tmem117 T C 15: 95,094,692 I411T probably damaging Het
Ttn T C 2: 76,868,377 T5A possibly damaging Het
Tubgcp3 T C 8: 12,658,381 probably null Het
Ush2a C T 1: 188,733,758 P2841L probably damaging Het
Vmn1r209 A T 13: 22,806,097 M141K probably benign Het
Vmn2r91 A T 17: 18,110,108 probably benign Het
Other mutations in Olfr1200
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Olfr1200 APN 2 88767466 missense probably benign 0.01
PIT4520001:Olfr1200 UTSW 2 88767577 missense possibly damaging 0.95
R0375:Olfr1200 UTSW 2 88767641 missense possibly damaging 0.77
R0525:Olfr1200 UTSW 2 88767314 nonsense probably null
R1467:Olfr1200 UTSW 2 88767488 missense probably benign 0.02
R1467:Olfr1200 UTSW 2 88767488 missense probably benign 0.02
R1613:Olfr1200 UTSW 2 88767805 missense probably damaging 1.00
R2224:Olfr1200 UTSW 2 88767586 missense possibly damaging 0.89
R2760:Olfr1200 UTSW 2 88767636 missense possibly damaging 0.61
R6156:Olfr1200 UTSW 2 88767590 missense probably benign 0.01
R6251:Olfr1200 UTSW 2 88768288 missense probably damaging 1.00
R6582:Olfr1200 UTSW 2 88768243 missense probably damaging 0.96
R6592:Olfr1200 UTSW 2 88768127 missense probably damaging 1.00
R6600:Olfr1200 UTSW 2 88767757 missense probably benign 0.02
R6774:Olfr1200 UTSW 2 88767884 missense probably benign 0.00
R7140:Olfr1200 UTSW 2 88767964 missense probably damaging 1.00
X0026:Olfr1200 UTSW 2 88767433 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGGCAGACTGAGCACCATC -3'
(R):5'- ATGGGTCTTTGGGAGAATAGAC -3'

Sequencing Primer
(F):5'- GTATCCAGGCCGTGACAATC -3'
(R):5'- GACAAATAGAGTTGCTGTTCTTTTTC -3'
Posted On2015-02-18