Incidental Mutation 'R3434:Ift74'
ID266336
Institutional Source Beutler Lab
Gene Symbol Ift74
Ensembl Gene ENSMUSG00000028576
Gene Nameintraflagellar transport 74
SynonymsCmg1, 1700029H06Rik, Ccdc2, b2b796Clo
MMRRC Submission 040652-MU
Accession Numbers

NCBI RefSeq: NM_026319.2; MGI: 1914944

Is this an essential gene? Possibly essential (E-score: 0.551) question?
Stock #R3434 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location94614491-94693229 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to G at 94621852 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030311] [ENSMUST00000107104]
Predicted Effect probably null
Transcript: ENSMUST00000030311
SMART Domains Protein: ENSMUSP00000030311
Gene: ENSMUSG00000028576

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
low complexity region 47 62 N/A INTRINSIC
coiled coil region 98 271 N/A INTRINSIC
coiled coil region 302 382 N/A INTRINSIC
coiled coil region 430 490 N/A INTRINSIC
coiled coil region 512 546 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107104
SMART Domains Protein: ENSMUSP00000102721
Gene: ENSMUSG00000028576

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
low complexity region 47 62 N/A INTRINSIC
coiled coil region 98 271 N/A INTRINSIC
coiled coil region 302 352 N/A INTRINSIC
Meta Mutation Damage Score 0.526 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit complex congenital heart disease associated with heterotaxy. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Targeted(2) Gene trapped(21)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G A 17: 24,289,537 A1008V probably damaging Het
Adora3 A G 3: 105,904,915 K39R probably benign Het
Ankib1 A G 5: 3,692,760 V1085A probably damaging Het
Atp7a G A X: 106,094,857 R563K probably benign Het
Azin1 T C 15: 38,493,576 I268V probably benign Het
Carm1 T C 9: 21,569,473 F81S probably damaging Het
Ccnjl A G 11: 43,579,861 Y152C probably damaging Het
Chrna3 T A 9: 55,024,326 I61F possibly damaging Het
Clca3a2 G A 3: 144,808,761 probably benign Het
Clstn2 T A 9: 97,454,715 D903V probably benign Het
Dpysl3 C T 18: 43,361,061 V70I probably benign Het
Drg2 A T 11: 60,461,392 K180* probably null Het
Dync2h1 A C 9: 7,011,236 H3659Q probably benign Het
Dysf A T 6: 84,070,888 Y349F probably benign Het
Epb41l4b T C 4: 57,040,865 N533D probably benign Het
Fam47e T A 5: 92,585,362 V152D probably damaging Het
Fasn G A 11: 120,822,773 A24V probably damaging Het
Fhl4 T C 10: 85,098,444 T158A probably benign Het
Fnbp1l C T 3: 122,546,306 R499Q probably damaging Het
Hdlbp A T 1: 93,428,161 M358K probably benign Het
Lhx4 A G 1: 155,702,401 Y332H probably damaging Het
Mast2 A T 4: 116,308,095 S1314T probably benign Het
Mast4 A G 13: 102,787,379 I508T probably damaging Het
Mdn1 T C 4: 32,733,726 probably null Het
Mrps23 A G 11: 88,210,114 K44E probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mup6 G T 4: 60,004,116 probably null Het
Notch3 A T 17: 32,158,618 D161E possibly damaging Het
Olfr1131 T C 2: 87,629,074 F204L probably benign Het
Olfr1200 T C 2: 88,768,069 D82G probably damaging Het
Olfr695 A T 7: 106,873,769 Y159N probably benign Het
P2rx4 T A 5: 122,725,070 I202K probably damaging Het
Phykpl A G 11: 51,598,655 T363A probably benign Het
Pitpnm1 G A 19: 4,112,234 A1047T probably damaging Het
Ppat A G 5: 76,918,065 I402T probably damaging Het
Rpgr A G X: 10,176,602 S656P probably benign Het
Rsbn1l T C 5: 20,905,930 probably benign Het
Sacs A G 14: 61,212,303 K3933E probably damaging Het
Scn7a T C 2: 66,675,503 I1681V probably benign Het
Sel1l3 T C 5: 53,117,090 D1016G probably benign Het
Sf3a3 C A 4: 124,725,077 T277N possibly damaging Het
Slc35a5 A G 16: 45,144,033 I279T probably benign Het
Slc39a10 T C 1: 46,835,717 T142A probably benign Het
Tle3 T A 9: 61,414,094 probably null Het
Tmem117 T C 15: 95,094,692 I411T probably damaging Het
Ttn T C 2: 76,868,377 T5A possibly damaging Het
Tubgcp3 T C 8: 12,658,381 probably null Het
Ush2a C T 1: 188,733,758 P2841L probably damaging Het
Vmn1r209 A T 13: 22,806,097 M141K probably benign Het
Vmn2r91 A T 17: 18,110,108 probably benign Het
Other mutations in Ift74
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Ift74 APN 4 94693022 missense probably damaging 1.00
IGL01534:Ift74 APN 4 94679944 missense probably benign 0.00
IGL01701:Ift74 APN 4 94662658 missense possibly damaging 0.94
IGL02155:Ift74 APN 4 94679251 missense probably benign
IGL02455:Ift74 APN 4 94635831 nonsense probably null
IGL02877:Ift74 APN 4 94624781 critical splice donor site probably null
IGL03389:Ift74 APN 4 94621912 missense possibly damaging 0.57
P0005:Ift74 UTSW 4 94662576 splice site probably benign
PIT4243001:Ift74 UTSW 4 94686904 missense possibly damaging 0.94
R0211:Ift74 UTSW 4 94679255 missense probably benign 0.05
R0211:Ift74 UTSW 4 94679255 missense probably benign 0.05
R1019:Ift74 UTSW 4 94635835 missense probably benign 0.20
R1240:Ift74 UTSW 4 94692937 splice site probably null
R1699:Ift74 UTSW 4 94685703 missense probably benign 0.09
R1937:Ift74 UTSW 4 94662646 missense probably benign 0.10
R2114:Ift74 UTSW 4 94627259 missense probably benign 0.00
R2116:Ift74 UTSW 4 94627259 missense probably benign 0.00
R2117:Ift74 UTSW 4 94627259 missense probably benign 0.00
R2181:Ift74 UTSW 4 94632714 missense probably damaging 0.98
R2680:Ift74 UTSW 4 94653028 missense probably damaging 1.00
R3435:Ift74 UTSW 4 94621852 critical splice acceptor site probably null
R4080:Ift74 UTSW 4 94652912 splice site probably null
R4379:Ift74 UTSW 4 94679934 missense probably benign 0.00
R4777:Ift74 UTSW 4 94652997 missense probably benign 0.00
R5197:Ift74 UTSW 4 94662596 missense probably benign 0.00
R5934:Ift74 UTSW 4 94632734 missense probably benign
R5994:Ift74 UTSW 4 94691724 missense possibly damaging 0.86
R6639:Ift74 UTSW 4 94664259 intron probably benign
R6781:Ift74 UTSW 4 94627302 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCGAAACACTAGATTCTGTAAAAGAG -3'
(R):5'- AGGATGTGCTATAACAGTTTTGGAAC -3'

Sequencing Primer
(F):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
(R):5'- CAGGACGATCAGCAACTT -3'
Posted On2015-02-18