Incidental Mutation 'R3434:Mast4'
ID266362
Institutional Source Beutler Lab
Gene Symbol Mast4
Ensembl Gene ENSMUSG00000034751
Gene Namemicrotubule associated serine/threonine kinase family member 4
Synonyms4930420O11Rik
MMRRC Submission 040652-MU
Accession Numbers

Genbank: NM_175171.3; EnsemblENSMUST00000167058 , ENSMUST00000167462, ENSMUST00000166726, ENSMUST00000164111 , ENSMUST00000166336, ENSMUST00000099202, ENSMUST00000172264, ENSMUST00000171791ENSMUST00000091273

Is this an essential gene? Possibly non essential (E-score: 0.491) question?
Stock #R3434 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location102732486-103334497 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102787379 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 508 (I508T)
Ref Sequence ENSEMBL: ENSMUSP00000128464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099202] [ENSMUST00000166726] [ENSMUST00000167058] [ENSMUST00000167462] [ENSMUST00000171791] [ENSMUST00000172264]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099202
AA Change: I331T

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000096808
Gene: ENSMUSG00000034751
AA Change: I331T

DomainStartEndE-ValueType
low complexity region 13 38 N/A INTRINSIC
Pfam:DUF1908 76 353 2.2e-146 PFAM
S_TKc 391 664 4.13e-98 SMART
S_TK_X 665 729 3.79e-2 SMART
low complexity region 745 758 N/A INTRINSIC
low complexity region 818 831 N/A INTRINSIC
low complexity region 840 857 N/A INTRINSIC
low complexity region 925 960 N/A INTRINSIC
PDZ 970 1050 2.34e-15 SMART
low complexity region 1070 1087 N/A INTRINSIC
low complexity region 1111 1122 N/A INTRINSIC
low complexity region 1127 1139 N/A INTRINSIC
low complexity region 1142 1164 N/A INTRINSIC
low complexity region 1202 1219 N/A INTRINSIC
low complexity region 1290 1306 N/A INTRINSIC
low complexity region 1345 1361 N/A INTRINSIC
low complexity region 1937 1953 N/A INTRINSIC
low complexity region 1996 2010 N/A INTRINSIC
low complexity region 2150 2161 N/A INTRINSIC
low complexity region 2296 2307 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166726
AA Change: I508T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000132263
Gene: ENSMUSG00000034751
AA Change: I508T

DomainStartEndE-ValueType
low complexity region 23 51 N/A INTRINSIC
Pfam:DUF1908 256 530 4.2e-145 PFAM
S_TKc 568 841 4.13e-98 SMART
S_TK_X 842 906 3.79e-2 SMART
low complexity region 922 935 N/A INTRINSIC
low complexity region 995 1008 N/A INTRINSIC
low complexity region 1035 1070 N/A INTRINSIC
PDZ 1080 1160 2.34e-15 SMART
low complexity region 1180 1201 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167058
AA Change: I508T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128464
Gene: ENSMUSG00000034751
AA Change: I508T

DomainStartEndE-ValueType
low complexity region 23 51 N/A INTRINSIC
Pfam:DUF1908 256 529 5.1e-134 PFAM
S_TKc 568 841 4.13e-98 SMART
S_TK_X 842 906 3.79e-2 SMART
low complexity region 922 935 N/A INTRINSIC
low complexity region 995 1008 N/A INTRINSIC
low complexity region 1017 1034 N/A INTRINSIC
low complexity region 1102 1137 N/A INTRINSIC
PDZ 1147 1227 2.34e-15 SMART
low complexity region 1247 1264 N/A INTRINSIC
low complexity region 1288 1299 N/A INTRINSIC
low complexity region 1304 1316 N/A INTRINSIC
low complexity region 1319 1341 N/A INTRINSIC
low complexity region 1379 1396 N/A INTRINSIC
low complexity region 1467 1483 N/A INTRINSIC
low complexity region 1522 1538 N/A INTRINSIC
low complexity region 2114 2130 N/A INTRINSIC
low complexity region 2173 2187 N/A INTRINSIC
low complexity region 2327 2338 N/A INTRINSIC
low complexity region 2473 2484 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167462
AA Change: I316T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000131910
Gene: ENSMUSG00000034751
AA Change: I316T

DomainStartEndE-ValueType
Pfam:DUF1908 64 338 3e-145 PFAM
S_TKc 376 649 4.13e-98 SMART
S_TK_X 650 714 3.79e-2 SMART
low complexity region 730 743 N/A INTRINSIC
low complexity region 803 816 N/A INTRINSIC
low complexity region 843 878 N/A INTRINSIC
PDZ 888 968 2.34e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171791
AA Change: I316T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131651
Gene: ENSMUSG00000034751
AA Change: I316T

DomainStartEndE-ValueType
Pfam:DUF1908 64 338 1.2e-144 PFAM
S_TKc 376 649 4.13e-98 SMART
S_TK_X 650 714 3.79e-2 SMART
low complexity region 730 743 N/A INTRINSIC
low complexity region 803 816 N/A INTRINSIC
low complexity region 825 842 N/A INTRINSIC
low complexity region 910 945 N/A INTRINSIC
PDZ 955 1035 2.34e-15 SMART
low complexity region 1055 1072 N/A INTRINSIC
low complexity region 1096 1107 N/A INTRINSIC
low complexity region 1112 1124 N/A INTRINSIC
low complexity region 1127 1149 N/A INTRINSIC
low complexity region 1187 1204 N/A INTRINSIC
low complexity region 1275 1291 N/A INTRINSIC
low complexity region 1330 1346 N/A INTRINSIC
low complexity region 1922 1938 N/A INTRINSIC
low complexity region 1981 1995 N/A INTRINSIC
low complexity region 2135 2146 N/A INTRINSIC
low complexity region 2281 2292 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172264
AA Change: I304T

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000128129
Gene: ENSMUSG00000034751
AA Change: I304T

DomainStartEndE-ValueType
Pfam:DUF1908 49 326 4.1e-147 PFAM
S_TKc 364 637 4.13e-98 SMART
S_TK_X 638 702 3.79e-2 SMART
low complexity region 718 731 N/A INTRINSIC
low complexity region 791 804 N/A INTRINSIC
low complexity region 813 830 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000194446
AA Change: I340T
Meta Mutation Damage Score 0.226 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the microtubule-associated serine/threonine protein kinases. The proteins in this family contain a domain that gives the kinase the ability to determine its own scaffold to control the effects of their kinase activities. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit malocclusion. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Gene trapped(8)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G A 17: 24,289,537 A1008V probably damaging Het
Adora3 A G 3: 105,904,915 K39R probably benign Het
Ankib1 A G 5: 3,692,760 V1085A probably damaging Het
Atp7a G A X: 106,094,857 R563K probably benign Het
Azin1 T C 15: 38,493,576 I268V probably benign Het
Carm1 T C 9: 21,569,473 F81S probably damaging Het
Ccnjl A G 11: 43,579,861 Y152C probably damaging Het
Chrna3 T A 9: 55,024,326 I61F possibly damaging Het
Clca3a2 G A 3: 144,808,761 probably benign Het
Clstn2 T A 9: 97,454,715 D903V probably benign Het
Dpysl3 C T 18: 43,361,061 V70I probably benign Het
Drg2 A T 11: 60,461,392 K180* probably null Het
Dync2h1 A C 9: 7,011,236 H3659Q probably benign Het
Dysf A T 6: 84,070,888 Y349F probably benign Het
Epb41l4b T C 4: 57,040,865 N533D probably benign Het
Fam47e T A 5: 92,585,362 V152D probably damaging Het
Fasn G A 11: 120,822,773 A24V probably damaging Het
Fhl4 T C 10: 85,098,444 T158A probably benign Het
Fnbp1l C T 3: 122,546,306 R499Q probably damaging Het
Hdlbp A T 1: 93,428,161 M358K probably benign Het
Ift74 A G 4: 94,621,852 probably null Het
Lhx4 A G 1: 155,702,401 Y332H probably damaging Het
Mast2 A T 4: 116,308,095 S1314T probably benign Het
Mdn1 T C 4: 32,733,726 probably null Het
Mrps23 A G 11: 88,210,114 K44E probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mup6 G T 4: 60,004,116 probably null Het
Notch3 A T 17: 32,158,618 D161E possibly damaging Het
Olfr1131 T C 2: 87,629,074 F204L probably benign Het
Olfr1200 T C 2: 88,768,069 D82G probably damaging Het
Olfr695 A T 7: 106,873,769 Y159N probably benign Het
P2rx4 T A 5: 122,725,070 I202K probably damaging Het
Phykpl A G 11: 51,598,655 T363A probably benign Het
Pitpnm1 G A 19: 4,112,234 A1047T probably damaging Het
Ppat A G 5: 76,918,065 I402T probably damaging Het
Rpgr A G X: 10,176,602 S656P probably benign Het
Rsbn1l T C 5: 20,905,930 probably benign Het
Sacs A G 14: 61,212,303 K3933E probably damaging Het
Scn7a T C 2: 66,675,503 I1681V probably benign Het
Sel1l3 T C 5: 53,117,090 D1016G probably benign Het
Sf3a3 C A 4: 124,725,077 T277N possibly damaging Het
Slc35a5 A G 16: 45,144,033 I279T probably benign Het
Slc39a10 T C 1: 46,835,717 T142A probably benign Het
Tle3 T A 9: 61,414,094 probably null Het
Tmem117 T C 15: 95,094,692 I411T probably damaging Het
Ttn T C 2: 76,868,377 T5A possibly damaging Het
Tubgcp3 T C 8: 12,658,381 probably null Het
Ush2a C T 1: 188,733,758 P2841L probably damaging Het
Vmn1r209 A T 13: 22,806,097 M141K probably benign Het
Vmn2r91 A T 17: 18,110,108 probably benign Het
Other mutations in Mast4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Mast4 APN 13 102770767 nonsense probably null
IGL00933:Mast4 APN 13 102735366 missense probably damaging 0.97
IGL01113:Mast4 APN 13 102774236 missense probably damaging 1.00
IGL01461:Mast4 APN 13 102754068 missense probably damaging 1.00
IGL01569:Mast4 APN 13 102761015 missense probably damaging 1.00
IGL01697:Mast4 APN 13 102767893 missense probably damaging 1.00
IGL01725:Mast4 APN 13 102750512 critical splice donor site probably null
IGL01734:Mast4 APN 13 102737615 missense probably damaging 0.98
IGL01738:Mast4 APN 13 102737241 missense probably damaging 1.00
IGL01739:Mast4 APN 13 102774273 missense probably damaging 1.00
IGL02299:Mast4 APN 13 102737974 missense probably benign 0.44
IGL02479:Mast4 APN 13 102742037 missense probably damaging 1.00
IGL02485:Mast4 APN 13 102735496 missense probably benign 0.02
IGL02528:Mast4 APN 13 102853823 makesense probably null
IGL02850:Mast4 APN 13 102754232 missense probably damaging 1.00
IGL02900:Mast4 APN 13 102735676 missense probably benign
IGL03064:Mast4 APN 13 102760964 nonsense probably null
IGL03124:Mast4 APN 13 102738245 missense probably damaging 1.00
IGL03146:Mast4 APN 13 102737655 missense probably benign 0.00
IGL03221:Mast4 APN 13 102754256 missense possibly damaging 0.95
IGL03284:Mast4 APN 13 102751397 missense probably damaging 1.00
IGL03406:Mast4 APN 13 102737107 missense possibly damaging 0.46
buck UTSW 13 102761293 critical splice donor site probably null
doe UTSW 13 102905677 missense possibly damaging 0.85
FR4304:Mast4 UTSW 13 102734862 utr 3 prime probably benign
FR4340:Mast4 UTSW 13 102734857 frame shift probably null
FR4340:Mast4 UTSW 13 102736317 small insertion probably benign
FR4548:Mast4 UTSW 13 102736318 small insertion probably benign
FR4976:Mast4 UTSW 13 102736312 small insertion probably benign
FR4976:Mast4 UTSW 13 102739247 frame shift probably null
NA:Mast4 UTSW 13 102742057 missense probably damaging 1.00
PIT4466001:Mast4 UTSW 13 102804718 missense probably damaging 1.00
PIT4469001:Mast4 UTSW 13 102804718 missense probably damaging 1.00
PIT4472001:Mast4 UTSW 13 102804718 missense probably damaging 1.00
R0009:Mast4 UTSW 13 102742058 missense probably damaging 1.00
R0063:Mast4 UTSW 13 103334215 start gained probably benign
R0242:Mast4 UTSW 13 102853842 missense probably damaging 1.00
R0310:Mast4 UTSW 13 102754161 missense possibly damaging 0.94
R0395:Mast4 UTSW 13 102735273 missense probably damaging 1.00
R0454:Mast4 UTSW 13 102751560 missense probably damaging 1.00
R0646:Mast4 UTSW 13 102758744 splice site probably benign
R0744:Mast4 UTSW 13 102737387 missense probably damaging 0.98
R0883:Mast4 UTSW 13 102853900 missense probably damaging 1.00
R0905:Mast4 UTSW 13 102770784 missense probably damaging 0.99
R1023:Mast4 UTSW 13 102735496 missense probably benign 0.02
R1281:Mast4 UTSW 13 102750578 missense probably damaging 1.00
R1376:Mast4 UTSW 13 102736408 missense possibly damaging 0.46
R1376:Mast4 UTSW 13 102736408 missense possibly damaging 0.46
R1473:Mast4 UTSW 13 102772519 missense probably damaging 1.00
R1572:Mast4 UTSW 13 102736923 missense possibly damaging 0.51
R1575:Mast4 UTSW 13 102739263 missense probably damaging 1.00
R1865:Mast4 UTSW 13 102794117 missense probably damaging 1.00
R2050:Mast4 UTSW 13 102751409 missense probably damaging 1.00
R2060:Mast4 UTSW 13 102738846 missense probably damaging 1.00
R2062:Mast4 UTSW 13 102759093 missense probably benign 0.18
R2106:Mast4 UTSW 13 102750546 missense probably damaging 1.00
R2118:Mast4 UTSW 13 102754205 missense probably damaging 1.00
R2143:Mast4 UTSW 13 102735475 missense possibly damaging 0.89
R2256:Mast4 UTSW 13 102735751 missense possibly damaging 0.62
R2261:Mast4 UTSW 13 102798207 splice site probably benign
R2370:Mast4 UTSW 13 102774187 missense probably damaging 1.00
R2504:Mast4 UTSW 13 102738639 missense probably damaging 0.96
R2509:Mast4 UTSW 13 102853842 missense probably damaging 1.00
R2842:Mast4 UTSW 13 102736431 missense probably benign 0.01
R3087:Mast4 UTSW 13 102853926 splice site probably benign
R3435:Mast4 UTSW 13 102787379 missense probably damaging 1.00
R3763:Mast4 UTSW 13 102787419 missense probably damaging 1.00
R3826:Mast4 UTSW 13 102738811 missense probably damaging 1.00
R3829:Mast4 UTSW 13 102738811 missense probably damaging 1.00
R3830:Mast4 UTSW 13 102738811 missense probably damaging 1.00
R3913:Mast4 UTSW 13 102758669 missense probably damaging 1.00
R3914:Mast4 UTSW 13 102739321 nonsense probably null
R4021:Mast4 UTSW 13 102739321 nonsense probably null
R4022:Mast4 UTSW 13 102739321 nonsense probably null
R4022:Mast4 UTSW 13 102853869 missense probably damaging 1.00
R4210:Mast4 UTSW 13 102739205 missense probably damaging 1.00
R4342:Mast4 UTSW 13 102774248 missense probably damaging 1.00
R4580:Mast4 UTSW 13 102737258 nonsense probably null
R4627:Mast4 UTSW 13 103334021 missense possibly damaging 0.92
R4711:Mast4 UTSW 13 103334119 missense probably benign 0.01
R4732:Mast4 UTSW 13 102772572 missense probably damaging 0.99
R4733:Mast4 UTSW 13 102772572 missense probably damaging 0.99
R4833:Mast4 UTSW 13 102774184 critical splice donor site probably null
R4995:Mast4 UTSW 13 102905754 intron probably benign
R5059:Mast4 UTSW 13 102750563 missense probably damaging 1.00
R5073:Mast4 UTSW 13 102738883 nonsense probably null
R5101:Mast4 UTSW 13 102736356 missense probably benign 0.01
R5526:Mast4 UTSW 13 102754215 missense possibly damaging 0.48
R5599:Mast4 UTSW 13 102737479 missense probably damaging 1.00
R5673:Mast4 UTSW 13 102794072 missense probably damaging 1.00
R5694:Mast4 UTSW 13 102774193 nonsense probably null
R5906:Mast4 UTSW 13 102735744 missense probably benign 0.31
R5908:Mast4 UTSW 13 102738256 missense probably damaging 1.00
R5947:Mast4 UTSW 13 102735640 missense probably benign
R5987:Mast4 UTSW 13 102758734 missense probably damaging 1.00
R6143:Mast4 UTSW 13 102853883 missense probably damaging 1.00
R6154:Mast4 UTSW 13 102787421 missense probably damaging 1.00
R6169:Mast4 UTSW 13 102787421 missense probably damaging 1.00
R6239:Mast4 UTSW 13 102736209 missense probably benign 0.01
R6327:Mast4 UTSW 13 102761382 missense probably damaging 1.00
R6356:Mast4 UTSW 13 102735985 missense possibly damaging 0.80
R6432:Mast4 UTSW 13 102905677 missense possibly damaging 0.85
R6522:Mast4 UTSW 13 102761293 critical splice donor site probably null
R6667:Mast4 UTSW 13 102737496 missense probably damaging 1.00
R6941:Mast4 UTSW 13 102804714 missense probably damaging 1.00
R6968:Mast4 UTSW 13 102798078 missense probably damaging 1.00
R6968:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6970:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6980:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6991:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6992:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6993:Mast4 UTSW 13 102735974 missense probably benign 0.28
R6993:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R7083:Mast4 UTSW 13 102737715 missense probably damaging 1.00
R7241:Mast4 UTSW 13 103334000 missense possibly damaging 0.87
R7242:Mast4 UTSW 13 102738478 missense probably damaging 1.00
R7246:Mast4 UTSW 13 102794003 missense probably damaging 1.00
R7332:Mast4 UTSW 13 102751424 missense possibly damaging 0.61
R7453:Mast4 UTSW 13 102804641 critical splice donor site probably null
R7514:Mast4 UTSW 13 102787426 nonsense probably null
Z1088:Mast4 UTSW 13 102738519 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACAGGCATGCTCACTGTC -3'
(R):5'- AACCATGTCAGCTTCGTTGTG -3'

Sequencing Primer
(F):5'- TACCTGGCCTCCCCCAAGAG -3'
(R):5'- CATGTCAGCTTCGTTGTGAGTGAG -3'
Posted On2015-02-18