Incidental Mutation 'R3434:Abca17'
ID266368
Institutional Source Beutler Lab
Gene Symbol Abca17
Ensembl Gene ENSMUSG00000035435
Gene NameATP-binding cassette, sub-family A (ABC1), member 17
Synonyms
MMRRC Submission 040652-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.327) question?
Stock #R3434 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location24264259-24351029 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 24289537 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 1008 (A1008V)
Ref Sequence ENSEMBL: ENSMUSP00000112538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039324] [ENSMUST00000121226]
Predicted Effect probably damaging
Transcript: ENSMUST00000039324
AA Change: A1008V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046218
Gene: ENSMUSG00000035435
AA Change: A1008V

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
transmembrane domain 22 44 N/A INTRINSIC
Pfam:ABC2_membrane_3 252 464 9.5e-17 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 6.7e-35 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121226
AA Change: A1008V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112538
Gene: ENSMUSG00000035435
AA Change: A1008V

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
Pfam:ABC2_membrane_3 21 464 1.2e-15 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 1.1e-32 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Meta Mutation Damage Score 0.0284 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adora3 A G 3: 105,904,915 K39R probably benign Het
Ankib1 A G 5: 3,692,760 V1085A probably damaging Het
Atp7a G A X: 106,094,857 R563K probably benign Het
Azin1 T C 15: 38,493,576 I268V probably benign Het
Carm1 T C 9: 21,569,473 F81S probably damaging Het
Ccnjl A G 11: 43,579,861 Y152C probably damaging Het
Chrna3 T A 9: 55,024,326 I61F possibly damaging Het
Clca3a2 G A 3: 144,808,761 probably benign Het
Clstn2 T A 9: 97,454,715 D903V probably benign Het
Dpysl3 C T 18: 43,361,061 V70I probably benign Het
Drg2 A T 11: 60,461,392 K180* probably null Het
Dync2h1 A C 9: 7,011,236 H3659Q probably benign Het
Dysf A T 6: 84,070,888 Y349F probably benign Het
Epb41l4b T C 4: 57,040,865 N533D probably benign Het
Fam47e T A 5: 92,585,362 V152D probably damaging Het
Fasn G A 11: 120,822,773 A24V probably damaging Het
Fhl4 T C 10: 85,098,444 T158A probably benign Het
Fnbp1l C T 3: 122,546,306 R499Q probably damaging Het
Hdlbp A T 1: 93,428,161 M358K probably benign Het
Ift74 A G 4: 94,621,852 probably null Het
Lhx4 A G 1: 155,702,401 Y332H probably damaging Het
Mast2 A T 4: 116,308,095 S1314T probably benign Het
Mast4 A G 13: 102,787,379 I508T probably damaging Het
Mdn1 T C 4: 32,733,726 probably null Het
Mrps23 A G 11: 88,210,114 K44E probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mup6 G T 4: 60,004,116 probably null Het
Notch3 A T 17: 32,158,618 D161E possibly damaging Het
Olfr1131 T C 2: 87,629,074 F204L probably benign Het
Olfr1200 T C 2: 88,768,069 D82G probably damaging Het
Olfr695 A T 7: 106,873,769 Y159N probably benign Het
P2rx4 T A 5: 122,725,070 I202K probably damaging Het
Phykpl A G 11: 51,598,655 T363A probably benign Het
Pitpnm1 G A 19: 4,112,234 A1047T probably damaging Het
Ppat A G 5: 76,918,065 I402T probably damaging Het
Rpgr A G X: 10,176,602 S656P probably benign Het
Rsbn1l T C 5: 20,905,930 probably benign Het
Sacs A G 14: 61,212,303 K3933E probably damaging Het
Scn7a T C 2: 66,675,503 I1681V probably benign Het
Sel1l3 T C 5: 53,117,090 D1016G probably benign Het
Sf3a3 C A 4: 124,725,077 T277N possibly damaging Het
Slc35a5 A G 16: 45,144,033 I279T probably benign Het
Slc39a10 T C 1: 46,835,717 T142A probably benign Het
Tle3 T A 9: 61,414,094 probably null Het
Tmem117 T C 15: 95,094,692 I411T probably damaging Het
Ttn T C 2: 76,868,377 T5A possibly damaging Het
Tubgcp3 T C 8: 12,658,381 probably null Het
Ush2a C T 1: 188,733,758 P2841L probably damaging Het
Vmn1r209 A T 13: 22,806,097 M141K probably benign Het
Vmn2r91 A T 17: 18,110,108 probably benign Het
Other mutations in Abca17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Abca17 APN 17 24295191 missense probably benign 0.14
IGL00585:Abca17 APN 17 24300320 missense probably damaging 0.99
IGL00941:Abca17 APN 17 24317130 missense probably damaging 1.00
IGL01987:Abca17 APN 17 24346228 missense probably benign 0.00
IGL01988:Abca17 APN 17 24334255 missense probably damaging 0.99
IGL02223:Abca17 APN 17 24287935 nonsense probably null
IGL02368:Abca17 APN 17 24287793 missense probably benign 0.01
IGL02405:Abca17 APN 17 24279062 missense possibly damaging 0.80
IGL02431:Abca17 APN 17 24298984 missense probably benign 0.05
IGL02607:Abca17 APN 17 24327705 nonsense probably null
IGL02706:Abca17 APN 17 24298992 missense probably benign 0.00
IGL02729:Abca17 APN 17 24280481 missense probably benign 0.06
IGL02818:Abca17 APN 17 24300352 missense probably benign 0.02
IGL02891:Abca17 APN 17 24281366 missense probably damaging 0.99
IGL03236:Abca17 APN 17 24326476 splice site probably benign
IGL03299:Abca17 APN 17 24265591 missense probably damaging 1.00
R0018:Abca17 UTSW 17 24313188 splice site probably null
R0467:Abca17 UTSW 17 24313177 splice site probably benign
R0671:Abca17 UTSW 17 24281249 missense probably benign 0.00
R1175:Abca17 UTSW 17 24289351 missense possibly damaging 0.91
R1397:Abca17 UTSW 17 24285759 missense probably benign 0.18
R1398:Abca17 UTSW 17 24328537 missense probably damaging 0.96
R1678:Abca17 UTSW 17 24335620 missense probably benign 0.05
R1696:Abca17 UTSW 17 24267658 missense possibly damaging 0.90
R1781:Abca17 UTSW 17 24267557 missense possibly damaging 0.95
R1845:Abca17 UTSW 17 24267716 missense probably damaging 1.00
R1970:Abca17 UTSW 17 24307575 missense probably benign 0.00
R1997:Abca17 UTSW 17 24285726 missense probably benign 0.02
R2141:Abca17 UTSW 17 24334266 missense probably benign 0.00
R2199:Abca17 UTSW 17 24335624 missense probably benign 0.19
R2394:Abca17 UTSW 17 24281216 splice site probably null
R2442:Abca17 UTSW 17 24328632 missense probably benign 0.02
R2509:Abca17 UTSW 17 24289613 splice site probably benign
R2848:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2849:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2859:Abca17 UTSW 17 24281314 missense possibly damaging 0.46
R2879:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2935:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R3153:Abca17 UTSW 17 24328746 missense probably damaging 1.00
R3154:Abca17 UTSW 17 24328746 missense probably damaging 1.00
R3695:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R3905:Abca17 UTSW 17 24296283 missense probably benign 0.13
R4282:Abca17 UTSW 17 24299060 missense possibly damaging 0.49
R4334:Abca17 UTSW 17 24318268 missense probably damaging 1.00
R4350:Abca17 UTSW 17 24279046 critical splice donor site probably null
R4548:Abca17 UTSW 17 24334271 missense possibly damaging 0.82
R4626:Abca17 UTSW 17 24321084 missense probably damaging 1.00
R4722:Abca17 UTSW 17 24265429 missense probably damaging 1.00
R4745:Abca17 UTSW 17 24307453 missense probably damaging 1.00
R4818:Abca17 UTSW 17 24317161 missense probably damaging 0.98
R5279:Abca17 UTSW 17 24289414 missense probably damaging 1.00
R5310:Abca17 UTSW 17 24281230 missense probably benign 0.00
R5320:Abca17 UTSW 17 24307567 missense probably damaging 1.00
R5435:Abca17 UTSW 17 24267614 missense possibly damaging 0.90
R5622:Abca17 UTSW 17 24327668 missense probably benign 0.14
R5776:Abca17 UTSW 17 24295158 missense probably benign 0.09
R5928:Abca17 UTSW 17 24318185 missense probably benign 0.01
R6013:Abca17 UTSW 17 24287846 missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24281245 missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24281245 missense possibly damaging 0.79
R6052:Abca17 UTSW 17 24318191 missense probably benign 0.00
R6063:Abca17 UTSW 17 24264344 missense unknown
R6404:Abca17 UTSW 17 24265918 missense probably benign 0.13
R6746:Abca17 UTSW 17 24346221 nonsense probably null
R6819:Abca17 UTSW 17 24287793 missense probably benign 0.01
R6828:Abca17 UTSW 17 24326415 missense possibly damaging 0.91
X0017:Abca17 UTSW 17 24317163 missense probably benign 0.26
X0065:Abca17 UTSW 17 24334284 missense probably damaging 1.00
Z1088:Abca17 UTSW 17 24279079 missense probably damaging 0.96
Z1088:Abca17 UTSW 17 24279107 missense probably benign 0.03
Z1088:Abca17 UTSW 17 24346219 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGACTCTGAGACCTCGATGG -3'
(R):5'- GGAGAGATCGGCTGGAATTC -3'

Sequencing Primer
(F):5'- TCTGAGACCTCGATGGCTGTC -3'
(R):5'- TCGGCTGGAATTCAATAGAGAGCTG -3'
Posted On2015-02-18