Incidental Mutation 'R3434:Pitpnm1'
ID266372
Institutional Source Beutler Lab
Gene Symbol Pitpnm1
Ensembl Gene ENSMUSG00000024851
Gene Namephosphatidylinositol transfer protein, membrane-associated 1
SynonymsDRES9, RdgB
MMRRC Submission 040652-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3434 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location4099998-4113965 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 4112234 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 1047 (A1047T)
Ref Sequence ENSEMBL: ENSMUSP00000097599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025767] [ENSMUST00000049658] [ENSMUST00000100022] [ENSMUST00000117831] [ENSMUST00000121402]
Predicted Effect probably benign
Transcript: ENSMUST00000025767
SMART Domains Protein: ENSMUSP00000025767
Gene: ENSMUSG00000024847

DomainStartEndE-ValueType
Pfam:FKBP_C 26 155 5.3e-11 PFAM
PDB:4APO|B 166 330 1e-113 PDB
SCOP:d1ihga1 170 322 1e-14 SMART
Blast:TPR 231 264 3e-7 BLAST
Blast:TPR 265 298 7e-7 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000049658
AA Change: A1047T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054309
Gene: ENSMUSG00000024851
AA Change: A1047T

DomainStartEndE-ValueType
Pfam:IP_trans 1 252 2e-145 PFAM
low complexity region 284 304 N/A INTRINSIC
low complexity region 310 319 N/A INTRINSIC
low complexity region 342 349 N/A INTRINSIC
low complexity region 514 522 N/A INTRINSIC
low complexity region 557 571 N/A INTRINSIC
low complexity region 578 593 N/A INTRINSIC
DDHD 685 879 5.94e-86 SMART
Blast:DDHD 880 963 2e-42 BLAST
LNS2 1022 1153 1.35e-57 SMART
low complexity region 1184 1195 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100022
AA Change: A1047T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097599
Gene: ENSMUSG00000024851
AA Change: A1047T

DomainStartEndE-ValueType
Pfam:IP_trans 1 250 1.6e-113 PFAM
low complexity region 284 304 N/A INTRINSIC
low complexity region 310 319 N/A INTRINSIC
low complexity region 342 349 N/A INTRINSIC
low complexity region 514 522 N/A INTRINSIC
low complexity region 557 571 N/A INTRINSIC
low complexity region 578 593 N/A INTRINSIC
DDHD 685 879 5.94e-86 SMART
Blast:DDHD 880 963 2e-42 BLAST
LNS2 1022 1153 1.35e-57 SMART
low complexity region 1184 1195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117831
SMART Domains Protein: ENSMUSP00000113807
Gene: ENSMUSG00000024847

DomainStartEndE-ValueType
Pfam:FKBP_C 26 155 1e-10 PFAM
PDB:4APO|B 166 330 1e-113 PDB
SCOP:d1ihga1 170 322 1e-14 SMART
Blast:TPR 231 264 3e-7 BLAST
Blast:TPR 265 298 7e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000121402
SMART Domains Protein: ENSMUSP00000114096
Gene: ENSMUSG00000024847

DomainStartEndE-ValueType
Pfam:FKBP_C 26 155 1.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125596
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126620
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127056
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145214
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145915
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151957
Meta Mutation Damage Score 0.398 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PITPNM1 belongs to a family of membrane-associated phosphatidylinositol transfer domain-containing proteins that share homology with the Drosophila retinal degeneration B (rdgB) protein (Ocaka et al., 2005 [PubMed 15627748]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male-specific decrease in circulating cholesterol and circulating calcium levels and female-specific decreased leukocyte cell numbers and a slight increase in auditory brainstem response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G A 17: 24,289,537 A1008V probably damaging Het
Adora3 A G 3: 105,904,915 K39R probably benign Het
Ankib1 A G 5: 3,692,760 V1085A probably damaging Het
Atp7a G A X: 106,094,857 R563K probably benign Het
Azin1 T C 15: 38,493,576 I268V probably benign Het
Carm1 T C 9: 21,569,473 F81S probably damaging Het
Ccnjl A G 11: 43,579,861 Y152C probably damaging Het
Chrna3 T A 9: 55,024,326 I61F possibly damaging Het
Clca3a2 G A 3: 144,808,761 probably benign Het
Clstn2 T A 9: 97,454,715 D903V probably benign Het
Dpysl3 C T 18: 43,361,061 V70I probably benign Het
Drg2 A T 11: 60,461,392 K180* probably null Het
Dync2h1 A C 9: 7,011,236 H3659Q probably benign Het
Dysf A T 6: 84,070,888 Y349F probably benign Het
Epb41l4b T C 4: 57,040,865 N533D probably benign Het
Fam47e T A 5: 92,585,362 V152D probably damaging Het
Fasn G A 11: 120,822,773 A24V probably damaging Het
Fhl4 T C 10: 85,098,444 T158A probably benign Het
Fnbp1l C T 3: 122,546,306 R499Q probably damaging Het
Hdlbp A T 1: 93,428,161 M358K probably benign Het
Ift74 A G 4: 94,621,852 probably null Het
Lhx4 A G 1: 155,702,401 Y332H probably damaging Het
Mast2 A T 4: 116,308,095 S1314T probably benign Het
Mast4 A G 13: 102,787,379 I508T probably damaging Het
Mdn1 T C 4: 32,733,726 probably null Het
Mrps23 A G 11: 88,210,114 K44E probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mup6 G T 4: 60,004,116 probably null Het
Notch3 A T 17: 32,158,618 D161E possibly damaging Het
Olfr1131 T C 2: 87,629,074 F204L probably benign Het
Olfr1200 T C 2: 88,768,069 D82G probably damaging Het
Olfr695 A T 7: 106,873,769 Y159N probably benign Het
P2rx4 T A 5: 122,725,070 I202K probably damaging Het
Phykpl A G 11: 51,598,655 T363A probably benign Het
Ppat A G 5: 76,918,065 I402T probably damaging Het
Rpgr A G X: 10,176,602 S656P probably benign Het
Rsbn1l T C 5: 20,905,930 probably benign Het
Sacs A G 14: 61,212,303 K3933E probably damaging Het
Scn7a T C 2: 66,675,503 I1681V probably benign Het
Sel1l3 T C 5: 53,117,090 D1016G probably benign Het
Sf3a3 C A 4: 124,725,077 T277N possibly damaging Het
Slc35a5 A G 16: 45,144,033 I279T probably benign Het
Slc39a10 T C 1: 46,835,717 T142A probably benign Het
Tle3 T A 9: 61,414,094 probably null Het
Tmem117 T C 15: 95,094,692 I411T probably damaging Het
Ttn T C 2: 76,868,377 T5A possibly damaging Het
Tubgcp3 T C 8: 12,658,381 probably null Het
Ush2a C T 1: 188,733,758 P2841L probably damaging Het
Vmn1r209 A T 13: 22,806,097 M141K probably benign Het
Vmn2r91 A T 17: 18,110,108 probably benign Het
Other mutations in Pitpnm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Pitpnm1 APN 19 4110665 splice site probably null
IGL00978:Pitpnm1 APN 19 4101228 missense possibly damaging 0.61
IGL02039:Pitpnm1 APN 19 4105032 missense probably benign 0.01
IGL02122:Pitpnm1 APN 19 4107796 missense probably damaging 1.00
IGL02279:Pitpnm1 APN 19 4101207 missense probably damaging 1.00
IGL02316:Pitpnm1 APN 19 4112835 missense probably benign 0.16
IGL02434:Pitpnm1 APN 19 4103377 missense probably benign 0.00
R0926:Pitpnm1 UTSW 19 4112338 missense probably damaging 1.00
R1301:Pitpnm1 UTSW 19 4110831 splice site probably null
R1423:Pitpnm1 UTSW 19 4112392 missense probably damaging 1.00
R1592:Pitpnm1 UTSW 19 4106964 critical splice donor site probably null
R1733:Pitpnm1 UTSW 19 4109960 nonsense probably null
R1844:Pitpnm1 UTSW 19 4112395 missense probably damaging 1.00
R1971:Pitpnm1 UTSW 19 4112450 missense probably damaging 1.00
R1978:Pitpnm1 UTSW 19 4107973 unclassified probably null
R2016:Pitpnm1 UTSW 19 4111873 missense probably benign 0.25
R2017:Pitpnm1 UTSW 19 4111873 missense probably benign 0.25
R2019:Pitpnm1 UTSW 19 4113641 missense probably damaging 1.00
R2210:Pitpnm1 UTSW 19 4105253 missense probably damaging 1.00
R2393:Pitpnm1 UTSW 19 4110935 missense probably benign 0.02
R3439:Pitpnm1 UTSW 19 4112752 missense probably benign 0.00
R4554:Pitpnm1 UTSW 19 4103085 missense probably benign 0.16
R4555:Pitpnm1 UTSW 19 4103085 missense probably benign 0.16
R4557:Pitpnm1 UTSW 19 4103085 missense probably benign 0.16
R4831:Pitpnm1 UTSW 19 4108130 missense probably damaging 1.00
R4874:Pitpnm1 UTSW 19 4112252 critical splice donor site probably null
R5058:Pitpnm1 UTSW 19 4112758 missense probably benign 0.00
R5069:Pitpnm1 UTSW 19 4111140 missense probably benign 0.44
R5249:Pitpnm1 UTSW 19 4108130 missense probably damaging 1.00
R5288:Pitpnm1 UTSW 19 4103435 missense probably damaging 0.99
R5385:Pitpnm1 UTSW 19 4103435 missense probably damaging 0.99
R5619:Pitpnm1 UTSW 19 4103270 missense probably damaging 1.00
R5650:Pitpnm1 UTSW 19 4103319 missense possibly damaging 0.78
R6267:Pitpnm1 UTSW 19 4110522 missense probably damaging 1.00
R6341:Pitpnm1 UTSW 19 4102829 nonsense probably null
R6608:Pitpnm1 UTSW 19 4110875 missense probably damaging 1.00
R6739:Pitpnm1 UTSW 19 4110522 missense probably damaging 1.00
R6915:Pitpnm1 UTSW 19 4106947 missense possibly damaging 0.95
R7141:Pitpnm1 UTSW 19 4102787 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TAAGCAGCAGGTATCTGGGC -3'
(R):5'- AAGTTGTGTTGCGACAGCCAG -3'

Sequencing Primer
(F):5'- AGCAGGTATCTGGGCTCCTG -3'
(R):5'- GGCCACTACACGGTGCTTTTG -3'
Posted On2015-02-18