Incidental Mutation 'R3434:Atp7a'
ID266375
Institutional Source Beutler Lab
Gene Symbol Atp7a
Ensembl Gene ENSMUSG00000033792
Gene NameATPase, Cu++ transporting, alpha polypeptide
SynonymsMNK, br, Menkes protein
MMRRC Submission 040652-MU
Accession Numbers

Genbank: NM_009726; MGI: 99400

Is this an essential gene? Probably essential (E-score: 0.754) question?
Stock #R3434 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location106027276-106124926 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 106094857 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 563 (R563K)
Ref Sequence ENSEMBL: ENSMUSP00000058840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055941] [ENSMUST00000113557]
Predicted Effect probably benign
Transcript: ENSMUST00000055941
AA Change: R563K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000058840
Gene: ENSMUSG00000033792
AA Change: R563K

DomainStartEndE-ValueType
Pfam:HMA 11 72 1.8e-16 PFAM
Pfam:HMA 174 235 3.2e-14 PFAM
Pfam:HMA 280 342 1.5e-15 PFAM
low complexity region 348 362 N/A INTRINSIC
Pfam:HMA 380 441 1.2e-17 PFAM
Pfam:HMA 484 544 6.7e-14 PFAM
Pfam:HMA 559 620 7.3e-15 PFAM
transmembrane domain 644 666 N/A INTRINSIC
low complexity region 698 713 N/A INTRINSIC
Pfam:E1-E2_ATPase 777 1025 1.4e-62 PFAM
Pfam:Hydrolase 1030 1305 1.4e-66 PFAM
Pfam:HAD 1033 1302 3.3e-12 PFAM
Pfam:Hydrolase_3 1273 1337 6.2e-7 PFAM
transmembrane domain 1351 1373 N/A INTRINSIC
transmembrane domain 1377 1399 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113557
AA Change: R562K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000109186
Gene: ENSMUSG00000033792
AA Change: R562K

DomainStartEndE-ValueType
Pfam:HMA 11 72 2.7e-14 PFAM
Pfam:HMA 174 235 2e-13 PFAM
Pfam:HMA 280 344 2.4e-14 PFAM
low complexity region 348 362 N/A INTRINSIC
Pfam:HMA 380 441 5.1e-16 PFAM
Pfam:HMA 482 543 1.9e-12 PFAM
Pfam:HMA 558 619 1.8e-14 PFAM
transmembrane domain 643 665 N/A INTRINSIC
low complexity region 697 712 N/A INTRINSIC
Pfam:E1-E2_ATPase 777 1025 2.2e-51 PFAM
Pfam:Hydrolase 1029 1304 3.9e-76 PFAM
Pfam:HAD 1032 1301 4.5e-14 PFAM
Pfam:Hydrolase_3 1272 1336 2.1e-6 PFAM
transmembrane domain 1350 1372 N/A INTRINSIC
transmembrane domain 1376 1398 N/A INTRINSIC
Meta Mutation Damage Score 0.1092 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that functions in copper transport across membranes. This protein is localized to the trans Golgi network, where it is predicted to supply copper to copper-dependent enzymes in the secretory pathway. It relocalizes to the plasma membrane under conditions of elevated extracellular copper, and functions in the efflux of copper from cells. Mutations in this gene are associated with Menkes disease, X-linked distal spinal muscular atrophy, and occipital horn syndrome. Alternatively-spliced transcript variants have been observed. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mutations in this gene affect copper metabolism and, depending on the allele, result in abnormal pigmentation, vibrissae, hair, and skeleton. Behavior may be abnormal and defects of collagen and elastin fibers are reported. Some alleles are hemizygous lethal. [provided by MGI curators]
Allele List at MGI
All alleles(88) : Targeted, other(2) Gene trapped(48) Spontaneous(23) Chemically induced(9) Radiation induced(8)
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G A 17: 24,289,537 A1008V probably damaging Het
Adora3 A G 3: 105,904,915 K39R probably benign Het
Ankib1 A G 5: 3,692,760 V1085A probably damaging Het
Azin1 T C 15: 38,493,576 I268V probably benign Het
Carm1 T C 9: 21,569,473 F81S probably damaging Het
Ccnjl A G 11: 43,579,861 Y152C probably damaging Het
Chrna3 T A 9: 55,024,326 I61F possibly damaging Het
Clca3a2 G A 3: 144,808,761 probably benign Het
Clstn2 T A 9: 97,454,715 D903V probably benign Het
Dpysl3 C T 18: 43,361,061 V70I probably benign Het
Drg2 A T 11: 60,461,392 K180* probably null Het
Dync2h1 A C 9: 7,011,236 H3659Q probably benign Het
Dysf A T 6: 84,070,888 Y349F probably benign Het
Epb41l4b T C 4: 57,040,865 N533D probably benign Het
Fam47e T A 5: 92,585,362 V152D probably damaging Het
Fasn G A 11: 120,822,773 A24V probably damaging Het
Fhl4 T C 10: 85,098,444 T158A probably benign Het
Fnbp1l C T 3: 122,546,306 R499Q probably damaging Het
Hdlbp A T 1: 93,428,161 M358K probably benign Het
Ift74 A G 4: 94,621,852 probably null Het
Lhx4 A G 1: 155,702,401 Y332H probably damaging Het
Mast2 A T 4: 116,308,095 S1314T probably benign Het
Mast4 A G 13: 102,787,379 I508T probably damaging Het
Mdn1 T C 4: 32,733,726 probably null Het
Mrps23 A G 11: 88,210,114 K44E probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mup6 G T 4: 60,004,116 probably null Het
Notch3 A T 17: 32,158,618 D161E possibly damaging Het
Olfr1131 T C 2: 87,629,074 F204L probably benign Het
Olfr1200 T C 2: 88,768,069 D82G probably damaging Het
Olfr695 A T 7: 106,873,769 Y159N probably benign Het
P2rx4 T A 5: 122,725,070 I202K probably damaging Het
Phykpl A G 11: 51,598,655 T363A probably benign Het
Pitpnm1 G A 19: 4,112,234 A1047T probably damaging Het
Ppat A G 5: 76,918,065 I402T probably damaging Het
Rpgr A G X: 10,176,602 S656P probably benign Het
Rsbn1l T C 5: 20,905,930 probably benign Het
Sacs A G 14: 61,212,303 K3933E probably damaging Het
Scn7a T C 2: 66,675,503 I1681V probably benign Het
Sel1l3 T C 5: 53,117,090 D1016G probably benign Het
Sf3a3 C A 4: 124,725,077 T277N possibly damaging Het
Slc35a5 A G 16: 45,144,033 I279T probably benign Het
Slc39a10 T C 1: 46,835,717 T142A probably benign Het
Tle3 T A 9: 61,414,094 probably null Het
Tmem117 T C 15: 95,094,692 I411T probably damaging Het
Ttn T C 2: 76,868,377 T5A possibly damaging Het
Tubgcp3 T C 8: 12,658,381 probably null Het
Ush2a C T 1: 188,733,758 P2841L probably damaging Het
Vmn1r209 A T 13: 22,806,097 M141K probably benign Het
Vmn2r91 A T 17: 18,110,108 probably benign Het
Other mutations in Atp7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01505:Atp7a APN X 106109830 missense probably damaging 0.97
IGL02023:Atp7a APN X 106094982 missense probably damaging 0.99
IGL02597:Atp7a APN X 106069888 missense probably benign 0.44
IGL03285:Atp7a APN X 106109775 missense probably benign
brown UTSW X 106088491 missense probably damaging 1.00
Golden UTSW X unclassified
Silver UTSW X unclassified
Tigrou UTSW X 106088407 missense probably benign 0.04
Tigrou-like UTSW X 106105250 missense probably damaging 1.00
Ups UTSW X 106088491 missense probably damaging 1.00
R0240:Atp7a UTSW X 106109841 missense probably damaging 1.00
R0240:Atp7a UTSW X 106109841 missense probably damaging 1.00
R3435:Atp7a UTSW X 106094857 missense probably benign 0.00
R3756:Atp7a UTSW X 106101843 intron probably null
R4911:Atp7a UTSW X 106120374 missense probably damaging 0.99
R5072:Atp7a UTSW X 106109768 missense probably benign
R5073:Atp7a UTSW X 106109768 missense probably benign
R5074:Atp7a UTSW X 106109768 missense probably benign
Predicted Primers PCR Primer
(F):5'- CATCAGAGGTGGTATTCCCTC -3'
(R):5'- CCAGATGTGATTCCAGAAGGTG -3'

Sequencing Primer
(F):5'- GAGGTGGTATTCCCTCATAATATCAG -3'
(R):5'- CCAGAAGGTGGTTGACTGG -3'
Posted On2015-02-18