Incidental Mutation 'R2867:Pcdh7'
ID266385
Institutional Source Beutler Lab
Gene Symbol Pcdh7
Ensembl Gene ENSMUSG00000029108
Gene Nameprotocadherin 7
SynonymsBH-protocadherin
MMRRC Submission 040456-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.311) question?
Stock #R2867 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location57717967-58133230 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 57721894 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 930 (K930N)
Ref Sequence ENSEMBL: ENSMUSP00000142319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068110] [ENSMUST00000094783] [ENSMUST00000191837] [ENSMUST00000199310]
Predicted Effect probably damaging
Transcript: ENSMUST00000068110
AA Change: K930N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000066306
Gene: ENSMUSG00000029108
AA Change: K930N

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
CA 48 141 7.29e-4 SMART
CA 165 306 1.13e-18 SMART
CA 330 413 2.12e-23 SMART
CA 445 533 1.53e-20 SMART
CA 557 637 1.36e-26 SMART
CA 661 740 2.38e-26 SMART
CA 766 847 2.01e-15 SMART
transmembrane domain 878 900 N/A INTRINSIC
low complexity region 929 944 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000094783
AA Change: K930N
SMART Domains Protein: ENSMUSP00000092376
Gene: ENSMUSG00000029108
AA Change: K930N

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
CA 48 141 7.29e-4 SMART
CA 165 306 1.13e-18 SMART
CA 330 413 2.12e-23 SMART
CA 445 533 1.53e-20 SMART
CA 557 637 1.36e-26 SMART
CA 661 740 2.38e-26 SMART
CA 766 847 2.01e-15 SMART
transmembrane domain 878 900 N/A INTRINSIC
low complexity region 929 944 N/A INTRINSIC
low complexity region 1088 1099 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180708
Predicted Effect probably damaging
Transcript: ENSMUST00000191837
AA Change: K930N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142319
Gene: ENSMUSG00000029108
AA Change: K930N

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
CA 48 141 7.29e-4 SMART
CA 165 306 1.13e-18 SMART
CA 330 413 2.12e-23 SMART
CA 445 533 1.53e-20 SMART
CA 557 637 1.36e-26 SMART
CA 661 740 2.38e-26 SMART
CA 766 847 2.01e-15 SMART
transmembrane domain 878 900 N/A INTRINSIC
low complexity region 929 944 N/A INTRINSIC
low complexity region 1088 1099 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192048
Predicted Effect unknown
Transcript: ENSMUST00000192287
AA Change: K590N
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193156
Predicted Effect unknown
Transcript: ENSMUST00000195156
AA Change: K244N
Predicted Effect probably benign
Transcript: ENSMUST00000199310
SMART Domains Protein: ENSMUSP00000143387
Gene: ENSMUSG00000029108

DomainStartEndE-ValueType
Pfam:Protocadherin 1 79 5.1e-40 PFAM
low complexity region 112 123 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200266
Meta Mutation Damage Score 0.112 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The gene encodes a protein with an extracellular domain containing 7 cadherin repeats. The gene product is an integral membrane protein that is thought to function in cell-cell recognition and adhesion. Alternative splicing yields isoforms with unique cytoplasmic tails. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adss T C 1: 177,767,812 probably null Het
Arid3c T C 4: 41,725,958 D215G probably damaging Het
Birc2 A C 9: 7,834,477 M1R probably null Het
Caprin2 G A 6: 148,846,240 silent Het
Cog4 C A 8: 110,866,659 probably benign Het
Cpz T C 5: 35,502,361 K647E probably benign Het
Ctnna2 T C 6: 77,114,922 probably benign Het
Cyp7a1 T C 4: 6,272,493 E240G probably damaging Het
Efhc2 A T X: 17,161,245 probably benign Homo
Epha6 T C 16: 59,960,296 probably null Het
Evc T A 5: 37,316,275 probably benign Het
Fbf1 A G 11: 116,161,448 probably benign Het
Grin2b A G 6: 135,733,639 F970L probably damaging Het
Gtf3c4 A G 2: 28,839,904 probably benign Het
Kcnma1 A T 14: 23,373,207 N682K probably benign Het
Kif20b A G 19: 34,940,128 E631G probably damaging Het
Lctl T C 9: 64,137,868 S550P probably benign Het
Lrrc6 A T 15: 66,438,408 L337* probably null Het
Mapk10 C T 5: 103,038,682 D25N probably benign Het
Mgst2 A G 3: 51,664,533 silent Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
N4bp1 T C 8: 86,861,405 N302D probably benign Het
Pramef25 T A 4: 143,948,886 I457L probably benign Het
Proca1 A T 11: 78,204,980 N146I probably damaging Het
RP23-211L5.9 T C 6: 68,895,650 probably null Het
Ryr2 A T 13: 11,761,349 W1101R probably damaging Het
Slc35d3 T C 10: 19,849,463 T216A probably benign Het
Terb1 C T 8: 104,447,853 probably benign Het
Thnsl2 C A 6: 71,131,961 D289Y probably damaging Het
Tigd4 A G 3: 84,593,952 N59D possibly damaging Het
Togaram2 T C 17: 71,709,597 S649P probably benign Het
Tradd G T 8: 105,259,513 F182L probably benign Het
Trav17 A T 14: 53,806,926 Y50F probably benign Het
Usp37 A T 1: 74,450,532 D808E probably damaging Het
Usp42 G A 5: 143,715,464 P935S possibly damaging Het
Vmn2r23 A G 6: 123,713,164 D333G possibly damaging Het
Zfpm2 C T 15: 41,099,389 A149V probably benign Het
Other mutations in Pcdh7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Pcdh7 APN 5 57721464 missense probably damaging 1.00
IGL00920:Pcdh7 APN 5 57720131 missense probably damaging 0.96
IGL00990:Pcdh7 APN 5 57720464 missense possibly damaging 0.94
IGL01367:Pcdh7 APN 5 58129224 missense possibly damaging 0.67
IGL01388:Pcdh7 APN 5 57720204 missense probably damaging 1.00
IGL01543:Pcdh7 APN 5 57720765 missense probably damaging 1.00
IGL01750:Pcdh7 APN 5 57720422 missense probably damaging 1.00
IGL02010:Pcdh7 APN 5 58129255 missense probably benign
IGL02014:Pcdh7 APN 5 57719703 missense probably benign 0.03
IGL02269:Pcdh7 APN 5 57913322 missense probably damaging 1.00
IGL03051:Pcdh7 APN 5 58129073 missense probably damaging 0.99
P0037:Pcdh7 UTSW 5 57913248 missense probably benign 0.17
R0003:Pcdh7 UTSW 5 57913248 missense probably benign 0.17
R0421:Pcdh7 UTSW 5 57720060 missense probably damaging 1.00
R0551:Pcdh7 UTSW 5 57721994 missense probably damaging 0.99
R0562:Pcdh7 UTSW 5 57720063 missense probably damaging 0.99
R0732:Pcdh7 UTSW 5 57721315 missense probably damaging 1.00
R0755:Pcdh7 UTSW 5 57720322 missense possibly damaging 0.86
R1080:Pcdh7 UTSW 5 57719426 missense probably damaging 1.00
R1381:Pcdh7 UTSW 5 57721540 nonsense probably null
R1591:Pcdh7 UTSW 5 57720422 missense probably damaging 1.00
R1891:Pcdh7 UTSW 5 57720875 missense probably damaging 0.98
R2011:Pcdh7 UTSW 5 57719629 missense probably damaging 1.00
R2140:Pcdh7 UTSW 5 58128996 missense probably damaging 1.00
R2147:Pcdh7 UTSW 5 58129116 missense possibly damaging 0.51
R2848:Pcdh7 UTSW 5 57720276 missense probably damaging 1.00
R2867:Pcdh7 UTSW 5 57721894 missense probably damaging 1.00
R3719:Pcdh7 UTSW 5 58129032 missense probably damaging 1.00
R4075:Pcdh7 UTSW 5 57721808 missense probably damaging 1.00
R4231:Pcdh7 UTSW 5 57719289 missense possibly damaging 0.94
R4236:Pcdh7 UTSW 5 57719289 missense possibly damaging 0.94
R4352:Pcdh7 UTSW 5 57722019 missense possibly damaging 0.88
R4420:Pcdh7 UTSW 5 58129170 missense probably benign 0.03
R4449:Pcdh7 UTSW 5 57720485 missense probably damaging 1.00
R4584:Pcdh7 UTSW 5 57721283 missense probably damaging 1.00
R4686:Pcdh7 UTSW 5 58129169 missense probably benign
R4837:Pcdh7 UTSW 5 57720411 missense possibly damaging 0.89
R4838:Pcdh7 UTSW 5 57720804 missense probably damaging 1.00
R4947:Pcdh7 UTSW 5 57721916 missense probably damaging 0.98
R5053:Pcdh7 UTSW 5 57721601 missense probably damaging 0.99
R5068:Pcdh7 UTSW 5 57722166 missense probably damaging 1.00
R5117:Pcdh7 UTSW 5 57721748 missense probably benign 0.09
R5132:Pcdh7 UTSW 5 57728121 missense probably benign
R5248:Pcdh7 UTSW 5 58129173 missense probably damaging 0.97
R5294:Pcdh7 UTSW 5 57728111 splice site probably null
R5420:Pcdh7 UTSW 5 57720187 missense probably damaging 1.00
R5777:Pcdh7 UTSW 5 57719514 missense probably damaging 1.00
R5800:Pcdh7 UTSW 5 57722225 missense probably damaging 1.00
R5834:Pcdh7 UTSW 5 57721628 missense possibly damaging 0.90
R5870:Pcdh7 UTSW 5 57720411 missense possibly damaging 0.89
R5917:Pcdh7 UTSW 5 57721755 missense probably damaging 0.96
R6014:Pcdh7 UTSW 5 57721155 missense probably damaging 0.99
R6193:Pcdh7 UTSW 5 57720324 missense probably damaging 1.00
R6240:Pcdh7 UTSW 5 57721362 missense probably damaging 1.00
R6335:Pcdh7 UTSW 5 57942265 unclassified probably null
R6418:Pcdh7 UTSW 5 57721704 missense probably damaging 1.00
R6907:Pcdh7 UTSW 5 57719129 missense possibly damaging 0.53
R7058:Pcdh7 UTSW 5 57722240 missense probably damaging 0.99
R7069:Pcdh7 UTSW 5 57719784 missense probably benign 0.00
R7073:Pcdh7 UTSW 5 57720957 missense probably benign 0.19
X0021:Pcdh7 UTSW 5 57721484 missense possibly damaging 0.95
X0026:Pcdh7 UTSW 5 57719379 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCGAAGTTTGCATACCCCAC -3'
(R):5'- GGCCCACCATTAACAGATCG -3'

Sequencing Primer
(F):5'- TATAGCTGGTGACCCAAGCTATG -3'
(R):5'- TTAACAGATCGGTATCGGCC -3'
Posted On2015-02-18