Incidental Mutation 'R2867:Grin2b'
ID 266393
Institutional Source Beutler Lab
Gene Symbol Grin2b
Ensembl Gene ENSMUSG00000030209
Gene Name glutamate receptor, ionotropic, NMDA2B (epsilon 2)
Synonyms GluRepsilon2, GluN2B, NR2B, NMDAR2B, Nmdar2b
MMRRC Submission 040456-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2867 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 135690231-136150509 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 135710637 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 970 (F970L)
Ref Sequence ENSEMBL: ENSMUSP00000107536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000053880
AA Change: F970L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: F970L

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 106 306 8.6e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 4.8e-270 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111905
AA Change: F970L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: F970L

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 56 307 4.2e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 2.1e-245 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136027
Meta Mutation Damage Score 0.3681 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adss2 T C 1: 177,595,378 (GRCm39) probably null Het
Arid3c T C 4: 41,725,958 (GRCm39) D215G probably damaging Het
Birc2 A C 9: 7,834,478 (GRCm39) M1R probably null Het
Caprin2 G A 6: 148,747,738 (GRCm39) silent Het
Cog4 C A 8: 111,593,291 (GRCm39) probably benign Het
Cpz T C 5: 35,659,705 (GRCm39) K647E probably benign Het
Ctnna2 T C 6: 77,091,905 (GRCm39) probably benign Het
Cyp7a1 T C 4: 6,272,493 (GRCm39) E240G probably damaging Het
Dnaaf11 A T 15: 66,310,257 (GRCm39) L337* probably null Het
Efhc2 A T X: 17,027,484 (GRCm39) probably benign Homo
Epha6 T C 16: 59,780,659 (GRCm39) probably null Het
Evc T A 5: 37,473,619 (GRCm39) probably benign Het
Fbf1 A G 11: 116,052,274 (GRCm39) probably benign Het
Gtf3c4 A G 2: 28,729,916 (GRCm39) probably benign Het
Kcnma1 A T 14: 23,423,275 (GRCm39) N682K probably benign Het
Kif20b A G 19: 34,917,528 (GRCm39) E631G probably damaging Het
Lctl T C 9: 64,045,150 (GRCm39) S550P probably benign Het
Mapk10 C T 5: 103,186,548 (GRCm39) D25N probably benign Het
Mgst2 A G 3: 51,571,954 (GRCm39) silent Het
Mslnl G A 17: 25,961,908 (GRCm39) V128M probably damaging Het
N4bp1 T C 8: 87,588,033 (GRCm39) N302D probably benign Het
Pcdh7 A T 5: 57,879,236 (GRCm39) K930N probably damaging Het
Pramel16 T A 4: 143,675,456 (GRCm39) I457L probably benign Het
Proca1 A T 11: 78,095,806 (GRCm39) N146I probably damaging Het
RP23-211L5.9 T C 6: 68,872,634 (GRCm39) probably null Het
Ryr2 A T 13: 11,776,235 (GRCm39) W1101R probably damaging Het
Slc35d3 T C 10: 19,725,209 (GRCm39) T216A probably benign Het
Terb1 C T 8: 105,174,485 (GRCm39) probably benign Het
Thnsl2 C A 6: 71,108,945 (GRCm39) D289Y probably damaging Het
Tigd4 A G 3: 84,501,259 (GRCm39) N59D possibly damaging Het
Togaram2 T C 17: 72,016,592 (GRCm39) S649P probably benign Het
Tradd G T 8: 105,986,145 (GRCm39) F182L probably benign Het
Trav17 A T 14: 54,044,383 (GRCm39) Y50F probably benign Het
Usp37 A T 1: 74,489,691 (GRCm39) D808E probably damaging Het
Usp42 G A 5: 143,701,219 (GRCm39) P935S possibly damaging Het
Vmn2r23 A G 6: 123,690,123 (GRCm39) D333G possibly damaging Het
Zfpm2 C T 15: 40,962,785 (GRCm39) A149V probably benign Het
Other mutations in Grin2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Grin2b APN 6 135,713,329 (GRCm39) missense possibly damaging 0.55
IGL00835:Grin2b APN 6 135,710,568 (GRCm39) missense probably damaging 1.00
IGL01401:Grin2b APN 6 135,713,361 (GRCm39) missense probably damaging 1.00
IGL01523:Grin2b APN 6 136,021,263 (GRCm39) missense probably null 0.99
IGL01719:Grin2b APN 6 135,710,379 (GRCm39) missense probably damaging 0.97
IGL01907:Grin2b APN 6 135,710,738 (GRCm39) missense probably damaging 1.00
IGL01996:Grin2b APN 6 135,709,584 (GRCm39) missense probably damaging 1.00
IGL02309:Grin2b APN 6 135,713,470 (GRCm39) missense probably damaging 1.00
IGL02312:Grin2b APN 6 135,716,088 (GRCm39) missense probably damaging 1.00
IGL02409:Grin2b APN 6 136,020,906 (GRCm39) missense possibly damaging 0.89
IGL02527:Grin2b APN 6 135,900,389 (GRCm39) missense probably damaging 1.00
IGL02535:Grin2b APN 6 135,756,367 (GRCm39) missense possibly damaging 0.70
IGL02570:Grin2b APN 6 135,899,996 (GRCm39) missense probably damaging 1.00
IGL02702:Grin2b APN 6 135,716,130 (GRCm39) missense probably damaging 0.99
IGL03001:Grin2b APN 6 135,716,113 (GRCm39) missense probably damaging 1.00
IGL03274:Grin2b APN 6 135,757,253 (GRCm39) missense possibly damaging 0.90
R0055:Grin2b UTSW 6 135,900,201 (GRCm39) missense probably benign
R0055:Grin2b UTSW 6 135,900,201 (GRCm39) missense probably benign
R0164:Grin2b UTSW 6 135,755,646 (GRCm39) splice site probably benign
R0194:Grin2b UTSW 6 135,756,303 (GRCm39) missense probably damaging 1.00
R0594:Grin2b UTSW 6 135,710,927 (GRCm39) missense probably damaging 1.00
R1434:Grin2b UTSW 6 135,820,193 (GRCm39) missense probably benign 0.04
R1928:Grin2b UTSW 6 136,021,044 (GRCm39) missense probably damaging 1.00
R1942:Grin2b UTSW 6 135,709,730 (GRCm39) missense possibly damaging 0.93
R1996:Grin2b UTSW 6 136,021,209 (GRCm39) missense possibly damaging 0.52
R2002:Grin2b UTSW 6 135,710,243 (GRCm39) missense probably damaging 1.00
R2020:Grin2b UTSW 6 135,710,894 (GRCm39) missense probably benign 0.12
R2103:Grin2b UTSW 6 135,757,138 (GRCm39) missense probably benign 0.02
R2127:Grin2b UTSW 6 135,755,698 (GRCm39) missense probably benign 0.03
R2495:Grin2b UTSW 6 135,710,180 (GRCm39) missense probably damaging 1.00
R2656:Grin2b UTSW 6 135,710,427 (GRCm39) missense probably damaging 1.00
R2847:Grin2b UTSW 6 135,717,951 (GRCm39) missense probably damaging 1.00
R2866:Grin2b UTSW 6 135,710,637 (GRCm39) missense probably damaging 1.00
R2867:Grin2b UTSW 6 135,710,637 (GRCm39) missense probably damaging 1.00
R3196:Grin2b UTSW 6 135,709,453 (GRCm39) small deletion probably benign
R3418:Grin2b UTSW 6 135,820,108 (GRCm39) missense probably benign 0.02
R3808:Grin2b UTSW 6 135,900,269 (GRCm39) missense probably damaging 0.99
R4028:Grin2b UTSW 6 135,713,433 (GRCm39) missense probably damaging 1.00
R4602:Grin2b UTSW 6 135,755,739 (GRCm39) missense probably damaging 1.00
R4624:Grin2b UTSW 6 135,710,823 (GRCm39) missense probably damaging 0.99
R4677:Grin2b UTSW 6 135,751,870 (GRCm39) missense probably benign 0.13
R4744:Grin2b UTSW 6 135,755,697 (GRCm39) missense probably damaging 1.00
R5020:Grin2b UTSW 6 135,710,405 (GRCm39) missense probably benign 0.01
R5051:Grin2b UTSW 6 135,756,393 (GRCm39) missense possibly damaging 0.84
R5105:Grin2b UTSW 6 135,709,439 (GRCm39) missense probably benign 0.03
R5125:Grin2b UTSW 6 135,900,297 (GRCm39) missense possibly damaging 0.89
R5146:Grin2b UTSW 6 135,756,340 (GRCm39) missense probably damaging 1.00
R5318:Grin2b UTSW 6 135,710,916 (GRCm39) missense probably damaging 0.99
R5349:Grin2b UTSW 6 136,021,281 (GRCm39) missense possibly damaging 0.93
R5426:Grin2b UTSW 6 135,709,366 (GRCm39) missense probably damaging 1.00
R5438:Grin2b UTSW 6 135,713,304 (GRCm39) missense probably damaging 1.00
R5439:Grin2b UTSW 6 135,713,304 (GRCm39) missense probably damaging 1.00
R5440:Grin2b UTSW 6 135,713,304 (GRCm39) missense probably damaging 1.00
R5530:Grin2b UTSW 6 135,710,721 (GRCm39) missense probably benign 0.00
R5603:Grin2b UTSW 6 135,900,395 (GRCm39) missense probably damaging 1.00
R5657:Grin2b UTSW 6 135,710,085 (GRCm39) missense possibly damaging 0.48
R5788:Grin2b UTSW 6 135,717,962 (GRCm39) missense probably benign 0.24
R5941:Grin2b UTSW 6 135,713,371 (GRCm39) missense probably damaging 0.99
R6057:Grin2b UTSW 6 135,710,942 (GRCm39) missense possibly damaging 0.84
R6137:Grin2b UTSW 6 135,900,456 (GRCm39) missense possibly damaging 0.89
R6216:Grin2b UTSW 6 135,749,397 (GRCm39) missense probably damaging 1.00
R6309:Grin2b UTSW 6 135,710,025 (GRCm39) missense probably benign 0.00
R6316:Grin2b UTSW 6 135,757,277 (GRCm39) missense probably benign 0.00
R6419:Grin2b UTSW 6 135,717,965 (GRCm39) missense probably damaging 1.00
R6551:Grin2b UTSW 6 135,710,342 (GRCm39) missense probably damaging 1.00
R6612:Grin2b UTSW 6 135,717,996 (GRCm39) missense probably damaging 1.00
R6616:Grin2b UTSW 6 135,709,549 (GRCm39) missense probably benign
R6647:Grin2b UTSW 6 135,710,108 (GRCm39) missense probably damaging 1.00
R6806:Grin2b UTSW 6 135,751,826 (GRCm39) missense possibly damaging 0.84
R6976:Grin2b UTSW 6 135,757,198 (GRCm39) missense probably benign
R7033:Grin2b UTSW 6 135,900,036 (GRCm39) missense probably damaging 1.00
R7058:Grin2b UTSW 6 135,757,304 (GRCm39) missense probably damaging 0.97
R7144:Grin2b UTSW 6 135,710,474 (GRCm39) missense possibly damaging 0.50
R7190:Grin2b UTSW 6 135,709,946 (GRCm39) missense possibly damaging 0.46
R7238:Grin2b UTSW 6 135,757,249 (GRCm39) missense probably damaging 0.97
R7453:Grin2b UTSW 6 135,717,947 (GRCm39) missense possibly damaging 0.56
R7553:Grin2b UTSW 6 135,749,394 (GRCm39) missense possibly damaging 0.88
R7585:Grin2b UTSW 6 135,756,301 (GRCm39) missense probably damaging 0.99
R7615:Grin2b UTSW 6 135,900,362 (GRCm39) missense probably damaging 1.00
R7632:Grin2b UTSW 6 135,709,553 (GRCm39) missense probably benign 0.02
R7779:Grin2b UTSW 6 135,755,792 (GRCm39) nonsense probably null
R8058:Grin2b UTSW 6 135,710,225 (GRCm39) missense probably damaging 1.00
R8084:Grin2b UTSW 6 135,710,486 (GRCm39) missense probably benign 0.03
R8145:Grin2b UTSW 6 135,709,497 (GRCm39) missense probably benign 0.01
R8308:Grin2b UTSW 6 135,900,074 (GRCm39) missense probably damaging 0.99
R8357:Grin2b UTSW 6 135,709,197 (GRCm39) missense probably benign 0.00
R8379:Grin2b UTSW 6 135,899,967 (GRCm39) missense probably damaging 1.00
R8429:Grin2b UTSW 6 135,710,914 (GRCm39) missense probably damaging 1.00
R8457:Grin2b UTSW 6 135,709,197 (GRCm39) missense probably benign 0.00
R8746:Grin2b UTSW 6 135,899,985 (GRCm39) missense probably benign 0.02
R8925:Grin2b UTSW 6 135,749,339 (GRCm39) missense probably damaging 0.97
R8927:Grin2b UTSW 6 135,749,339 (GRCm39) missense probably damaging 0.97
R8963:Grin2b UTSW 6 136,021,007 (GRCm39) missense probably damaging 1.00
R9075:Grin2b UTSW 6 135,709,509 (GRCm39) frame shift probably null
R9076:Grin2b UTSW 6 135,709,509 (GRCm39) frame shift probably null
R9172:Grin2b UTSW 6 135,756,255 (GRCm39) missense possibly damaging 0.84
R9520:Grin2b UTSW 6 135,710,399 (GRCm39) missense probably damaging 1.00
R9740:Grin2b UTSW 6 135,899,868 (GRCm39) critical splice donor site probably null
RF001:Grin2b UTSW 6 136,021,238 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGAGAACTTGCCGTACAGGTC -3'
(R):5'- CCAACCTGTCTGGAGTCAAC -3'

Sequencing Primer
(F):5'- TTGCCGTACAGGTCGCTGAG -3'
(R):5'- TGTCTGGAGTCAACGGCTC -3'
Posted On 2015-02-18