Incidental Mutation 'R2867:Kif20b'
ID266411
Institutional Source Beutler Lab
Gene Symbol Kif20b
Ensembl Gene ENSMUSG00000024795
Gene Namekinesin family member 20B
SynonymsKif20b, Mphosph1, N-6 kinesin
MMRRC Submission 040456-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.624) question?
Stock #R2867 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location34922361-34975745 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34940128 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 631 (E631G)
Ref Sequence ENSEMBL: ENSMUSP00000153034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087341] [ENSMUST00000223907] [ENSMUST00000225408]
Predicted Effect probably damaging
Transcript: ENSMUST00000087341
AA Change: E631G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084599
Gene: ENSMUSG00000024795
AA Change: E631G

DomainStartEndE-ValueType
Blast:KISc 2 46 5e-15 BLAST
KISc 56 483 1.19e-103 SMART
low complexity region 521 551 N/A INTRINSIC
coiled coil region 565 602 N/A INTRINSIC
coiled coil region 705 746 N/A INTRINSIC
coiled coil region 823 947 N/A INTRINSIC
coiled coil region 1020 1325 N/A INTRINSIC
coiled coil region 1348 1510 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000223907
AA Change: E631G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000224728
Predicted Effect probably benign
Transcript: ENSMUST00000225408
Meta Mutation Damage Score 0.318 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (30/31)
MGI Phenotype PHENOTYPE: Mice homozygous for ENU induced mutations display craniofacial and nervous system abnormalities including exencephaly, microcephaly, decreased forebrain size and impaired neuronal progenitor proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adss T C 1: 177,767,812 probably null Het
Arid3c T C 4: 41,725,958 D215G probably damaging Het
Birc2 A C 9: 7,834,477 M1R probably null Het
Caprin2 G A 6: 148,846,240 silent Het
Cog4 C A 8: 110,866,659 probably benign Het
Cpz T C 5: 35,502,361 K647E probably benign Het
Ctnna2 T C 6: 77,114,922 probably benign Het
Cyp7a1 T C 4: 6,272,493 E240G probably damaging Het
Efhc2 A T X: 17,161,245 probably benign Homo
Epha6 T C 16: 59,960,296 probably null Het
Evc T A 5: 37,316,275 probably benign Het
Fbf1 A G 11: 116,161,448 probably benign Het
Grin2b A G 6: 135,733,639 F970L probably damaging Het
Gtf3c4 A G 2: 28,839,904 probably benign Het
Kcnma1 A T 14: 23,373,207 N682K probably benign Het
Lctl T C 9: 64,137,868 S550P probably benign Het
Lrrc6 A T 15: 66,438,408 L337* probably null Het
Mapk10 C T 5: 103,038,682 D25N probably benign Het
Mgst2 A G 3: 51,664,533 silent Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
N4bp1 T C 8: 86,861,405 N302D probably benign Het
Pcdh7 A T 5: 57,721,894 K930N probably damaging Het
Pramef25 T A 4: 143,948,886 I457L probably benign Het
Proca1 A T 11: 78,204,980 N146I probably damaging Het
RP23-211L5.9 T C 6: 68,895,650 probably null Het
Ryr2 A T 13: 11,761,349 W1101R probably damaging Het
Slc35d3 T C 10: 19,849,463 T216A probably benign Het
Terb1 C T 8: 104,447,853 probably benign Het
Thnsl2 C A 6: 71,131,961 D289Y probably damaging Het
Tigd4 A G 3: 84,593,952 N59D possibly damaging Het
Togaram2 T C 17: 71,709,597 S649P probably benign Het
Tradd G T 8: 105,259,513 F182L probably benign Het
Trav17 A T 14: 53,806,926 Y50F probably benign Het
Usp37 A T 1: 74,450,532 D808E probably damaging Het
Usp42 G A 5: 143,715,464 P935S possibly damaging Het
Vmn2r23 A G 6: 123,713,164 D333G possibly damaging Het
Zfpm2 C T 15: 41,099,389 A149V probably benign Het
Other mutations in Kif20b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Kif20b APN 19 34947660 missense possibly damaging 0.77
IGL01021:Kif20b APN 19 34938260 missense possibly damaging 0.89
IGL01590:Kif20b APN 19 34954726 missense possibly damaging 0.87
IGL01691:Kif20b APN 19 34935743 splice site probably benign
IGL01730:Kif20b APN 19 34950523 nonsense probably null
IGL02078:Kif20b APN 19 34935644 missense probably damaging 1.00
IGL02174:Kif20b APN 19 34934458 splice site probably benign
IGL02536:Kif20b APN 19 34974559 missense probably benign 0.42
IGL03029:Kif20b APN 19 34950913 missense probably benign
IGL03186:Kif20b APN 19 34934944 missense probably benign 0.45
IGL03205:Kif20b APN 19 34959463 missense probably damaging 1.00
IGL03493:Kif20b APN 19 34959550 nonsense probably null
R0319:Kif20b UTSW 19 34947732 splice site probably benign
R1069:Kif20b UTSW 19 34950851 missense probably damaging 1.00
R1137:Kif20b UTSW 19 34937086 critical splice donor site probably null
R1255:Kif20b UTSW 19 34950106 missense probably benign 0.08
R1352:Kif20b UTSW 19 34924635 missense probably benign
R1466:Kif20b UTSW 19 34950599 missense probably benign 0.00
R1466:Kif20b UTSW 19 34950599 missense probably benign 0.00
R1473:Kif20b UTSW 19 34974496 missense possibly damaging 0.93
R1545:Kif20b UTSW 19 34928918 missense probably damaging 1.00
R1647:Kif20b UTSW 19 34936790 missense possibly damaging 0.65
R1648:Kif20b UTSW 19 34936790 missense possibly damaging 0.65
R1752:Kif20b UTSW 19 34938336 missense probably benign 0.13
R1835:Kif20b UTSW 19 34956038 missense probably damaging 1.00
R1889:Kif20b UTSW 19 34941208 unclassified probably benign
R1937:Kif20b UTSW 19 34952878 missense possibly damaging 0.73
R2112:Kif20b UTSW 19 34931732 missense probably benign 0.04
R2315:Kif20b UTSW 19 34931599 missense probably damaging 1.00
R2385:Kif20b UTSW 19 34959419 missense probably damaging 0.98
R2867:Kif20b UTSW 19 34940128 missense probably damaging 1.00
R3086:Kif20b UTSW 19 34929715 missense probably damaging 1.00
R3116:Kif20b UTSW 19 34970080 missense probably benign 0.38
R3407:Kif20b UTSW 19 34950500 missense probably damaging 1.00
R3834:Kif20b UTSW 19 34935028 missense probably damaging 1.00
R3882:Kif20b UTSW 19 34950080 missense probably damaging 1.00
R4698:Kif20b UTSW 19 34951544 missense probably damaging 1.00
R4721:Kif20b UTSW 19 34938373 missense probably benign 0.41
R4883:Kif20b UTSW 19 34966122 missense probably benign 0.00
R4901:Kif20b UTSW 19 34934436 missense probably benign 0.00
R4923:Kif20b UTSW 19 34941211 critical splice acceptor site probably null
R5538:Kif20b UTSW 19 34952964 nonsense probably null
R5540:Kif20b UTSW 19 34938460 missense probably benign 0.01
R5558:Kif20b UTSW 19 34951549 missense probably damaging 1.00
R5580:Kif20b UTSW 19 34949728 splice site probably null
R5934:Kif20b UTSW 19 34941321 missense probably benign 0.02
R6019:Kif20b UTSW 19 34950464 missense probably benign 0.00
R6464:Kif20b UTSW 19 34934441 missense probably benign
R6613:Kif20b UTSW 19 34936984 nonsense probably null
R6745:Kif20b UTSW 19 34928876 missense possibly damaging 0.94
R7097:Kif20b UTSW 19 34974492 missense probably damaging 0.98
Z1088:Kif20b UTSW 19 34950451 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAACGGGAAGCCGATTTTAAGTAAG -3'
(R):5'- AGCATTTCTCATCATTAATGTGGGG -3'

Sequencing Primer
(F):5'- CTTCATAACCTGGCAAGAATTGAG -3'
(R):5'- GGGTATTAAATCCTGGTACCAAAAGC -3'
Posted On2015-02-18