Incidental Mutation 'R2870:Mlxip'
ID266504
Institutional Source Beutler Lab
Gene Symbol Mlxip
Ensembl Gene ENSMUSG00000038342
Gene NameMLX interacting protein
SynonymsMondoa, bHLHe36, Mir
MMRRC Submission 040458-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock #R2870 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location123394798-123457932 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123452667 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 878 (M878V)
Ref Sequence ENSEMBL: ENSMUSP00000064943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068237]
Predicted Effect probably benign
Transcript: ENSMUST00000068237
AA Change: M878V

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000064943
Gene: ENSMUSG00000038342
AA Change: M878V

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
low complexity region 27 44 N/A INTRINSIC
low complexity region 47 73 N/A INTRINSIC
PDB:4GNT|B 157 177 8e-7 PDB
low complexity region 347 363 N/A INTRINSIC
low complexity region 436 467 N/A INTRINSIC
low complexity region 514 539 N/A INTRINSIC
low complexity region 557 570 N/A INTRINSIC
low complexity region 632 643 N/A INTRINSIC
low complexity region 686 704 N/A INTRINSIC
HLH 723 773 2.81e-9 SMART
low complexity region 880 894 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135961
SMART Domains Protein: ENSMUSP00000120510
Gene: ENSMUSG00000038342

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
low complexity region 78 89 N/A INTRINSIC
low complexity region 132 150 N/A INTRINSIC
HLH 169 219 2.81e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199458
Meta Mutation Damage Score 0.112 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions as part of a heterodimer to activate transcription. The encoded protein forms a heterodimer with Max-like protein X (MLX) and is involved in the regulation of genes in response to cellular glucose levels. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik A T 10: 22,067,379 I234N probably benign Het
Actrt3 A G 3: 30,599,698 V51A probably damaging Het
Adgb C T 10: 10,431,281 probably null Het
AI481877 A C 4: 59,093,850 L226R probably damaging Het
Als2 A G 1: 59,211,137 S483P probably damaging Het
Ankrd10 C T 8: 11,615,682 R306H probably damaging Het
Arhgef10 T C 8: 14,975,093 probably null Het
Arhgef10 A G 8: 14,975,666 I459V probably benign Het
Armc2 C T 10: 41,966,700 probably null Het
Atp12a A G 14: 56,386,950 R952G possibly damaging Het
Atp6v1g1 A G 4: 63,550,021 Y87C probably benign Het
C030034I22Rik T A 17: 69,418,111 noncoding transcript Het
Cacna2d1 G A 5: 16,312,568 C404Y probably damaging Het
Ccdc163 T C 4: 116,741,861 silent Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Cd6 A G 19: 10,794,626 I307T possibly damaging Het
Clasrp C A 7: 19,585,240 probably benign Het
Csmd2 T C 4: 128,557,718 F113S unknown Het
Csmd3 C T 15: 47,857,924 G1437D probably damaging Het
Cyp4a14 C A 4: 115,487,301 G456W probably damaging Het
Cyp4a30b A G 4: 115,458,362 H260R possibly damaging Het
Dcp1b C T 6: 119,214,774 S217L probably benign Het
Dhx57 A T 17: 80,251,376 D1051E probably benign Het
Dmp1 A G 5: 104,212,108 S217G probably benign Het
Eif4enif1 C T 11: 3,242,586 P805S probably damaging Het
Eral1 A G 11: 78,076,278 I164T possibly damaging Het
Esr1 G A 10: 4,997,890 R481H probably damaging Het
Fam19a2 A T 10: 123,704,365 H42L possibly damaging Het
Fan1 A G 7: 64,363,190 I668T probably benign Het
Gbp11 C T 5: 105,331,000 D191N probably benign Het
Gm21759 T A 5: 8,180,863 probably benign Het
Gm5454 C A 13: 103,357,523 noncoding transcript Het
Gm9874 A T 17: 30,485,789 probably benign Het
Gria2 G A 3: 80,702,492 T670I probably damaging Het
Gria4 T A 9: 4,503,614 N334I probably damaging Het
Grm5 T C 7: 87,602,722 V60A possibly damaging Het
Ift172 C T 5: 31,257,861 V1335I probably benign Het
Ino80d C T 1: 63,061,039 probably null Het
Kif1c A G 11: 70,724,081 E567G probably damaging Het
Krt31 T G 11: 100,047,873 N298T possibly damaging Het
Mapk7 C A 11: 61,490,212 probably benign Het
March8 C T 6: 116,401,145 probably benign Het
Matr3 T A 18: 35,572,296 S91R probably benign Het
Mdm1 A G 10: 118,150,942 T267A probably benign Het
Mtm1 T C X: 71,296,362 probably benign Homo
Mtor T A 4: 148,540,030 M2089K probably benign Het
Mylk2 A G 2: 152,919,348 K457R probably damaging Het
Nell1 A T 7: 50,249,657 probably benign Het
Nomo1 C A 7: 46,046,937 T293N probably damaging Het
Odf3l2 G A 10: 79,645,653 T14I probably benign Het
Olfr1080 T C 2: 86,553,584 D180G possibly damaging Het
Olfr1510 T G 14: 52,410,861 T4P probably benign Het
Olfr801 A T 10: 129,669,759 C253* probably null Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Otud4 T A 8: 79,661,073 N300K possibly damaging Het
Otx1 A G 11: 21,998,681 probably benign Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Pcdhb20 A T 18: 37,505,780 Q453L possibly damaging Het
Pcdhga9 T A 18: 37,737,471 Y118N possibly damaging Het
Pes1 C A 11: 3,976,834 T372K probably benign Het
Plcl1 A T 1: 55,697,150 D550V probably benign Het
Plekhg5 T A 4: 152,107,503 C433S probably benign Het
Plin2 A G 4: 86,668,678 M1T probably null Het
Pold1 C T 7: 44,543,347 silent Het
Ppp1r7 T A 1: 93,357,863 probably null Het
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Pzp A T 6: 128,485,556 probably null Het
Rel T C 11: 23,761,129 I13V probably benign Het
Reln C T 5: 22,049,791 V527I possibly damaging Het
Retnla A G 16: 48,843,612 R90G probably benign Het
Slc39a8 T A 3: 135,886,793 probably null Het
Slc5a8 A G 10: 88,904,963 I247V probably benign Het
Son A G 16: 91,664,317 probably null Het
Spcs2 T C 7: 99,839,761 D240G probably damaging Het
St5 A T 7: 109,557,430 Y38N probably benign Het
Stx3 A T 19: 11,789,574 V91D probably damaging Het
Taf6l A G 19: 8,778,628 probably benign Het
Tbc1d8 A G 1: 39,405,317 F187S probably damaging Het
Thbs1 C G 2: 118,119,378 N611K probably damaging Het
Tipin A C 9: 64,304,327 S232R probably benign Het
Tmem132b A G 5: 125,638,268 D347G probably benign Het
Tmem161a C T 8: 70,178,915 probably benign Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Ybx3 G A 6: 131,370,413 A253V probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Zzz3 T A 3: 152,446,844 silent Het
Other mutations in Mlxip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Mlxip APN 5 123447205 missense probably benign 0.35
IGL00922:Mlxip APN 5 123440065 missense probably damaging 1.00
IGL01138:Mlxip APN 5 123450156 missense probably damaging 1.00
IGL01624:Mlxip APN 5 123395329 missense probably benign 0.08
IGL02155:Mlxip APN 5 123453392 missense probably benign
IGL03011:Mlxip APN 5 123445951 missense probably benign 0.01
IGL03177:Mlxip APN 5 123445981 missense possibly damaging 0.86
IGL03242:Mlxip APN 5 123440061 missense probably damaging 1.00
PIT4366001:Mlxip UTSW 5 123395110 missense probably benign 0.00
R0136:Mlxip UTSW 5 123442306 missense probably damaging 1.00
R1583:Mlxip UTSW 5 123450223 missense possibly damaging 0.86
R2410:Mlxip UTSW 5 123443069 missense probably damaging 1.00
R2869:Mlxip UTSW 5 123452667 missense probably benign 0.04
R2869:Mlxip UTSW 5 123452667 missense probably benign 0.04
R2870:Mlxip UTSW 5 123452667 missense probably benign 0.04
R2871:Mlxip UTSW 5 123452667 missense probably benign 0.04
R2871:Mlxip UTSW 5 123452667 missense probably benign 0.04
R2873:Mlxip UTSW 5 123452667 missense probably benign 0.04
R2962:Mlxip UTSW 5 123440824 missense probably damaging 0.99
R3709:Mlxip UTSW 5 123447474 missense probably benign 0.00
R4512:Mlxip UTSW 5 123395065 missense probably benign
R4536:Mlxip UTSW 5 123450503 missense probably damaging 0.97
R4722:Mlxip UTSW 5 123447202 missense probably benign 0.39
R4993:Mlxip UTSW 5 123395294 missense probably damaging 1.00
R5503:Mlxip UTSW 5 123395327 missense probably damaging 0.98
R5715:Mlxip UTSW 5 123440058 missense probably damaging 1.00
R6006:Mlxip UTSW 5 123445658 missense possibly damaging 0.93
R6330:Mlxip UTSW 5 123394952 missense probably benign
R6617:Mlxip UTSW 5 123442449 intron probably null
R6709:Mlxip UTSW 5 123447276 missense possibly damaging 0.89
R6970:Mlxip UTSW 5 123445672 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- TCAGCAGTCAACCTGGCTTG -3'
(R):5'- CAGGTCTGCTGAAAGCTTTCTGG -3'

Sequencing Primer
(F):5'- AGTCAACCTGGCTTGCCTGAG -3'
(R):5'- GAAAGCTTTCTGGATTCTAGGATCCC -3'
Posted On2015-02-18