Incidental Mutation 'R2870:Eral1'
ID266537
Institutional Source Beutler Lab
Gene Symbol Eral1
Ensembl Gene ENSMUSG00000020832
Gene NameEra (G-protein)-like 1 (E. coli)
Synonyms2610524P08Rik, 9130407C09Rik, MERA-W, MERA-S
MMRRC Submission 040458-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2870 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location78073376-78080383 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78076278 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 164 (I164T)
Ref Sequence ENSEMBL: ENSMUSP00000021183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021183]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021183
AA Change: I164T

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000021183
Gene: ENSMUSG00000020832
AA Change: I164T

DomainStartEndE-ValueType
low complexity region 79 92 N/A INTRINSIC
Pfam:AIG1 114 249 2.2e-11 PFAM
Pfam:FeoB_N 114 260 5e-10 PFAM
Pfam:MMR_HSR1 115 237 4e-21 PFAM
Pfam:Dynamin_N 116 162 1.6e-6 PFAM
Pfam:KH_2 363 437 6.3e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083467
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135154
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139731
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196157
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a GTPase that localizes to the mitochondrion. The encoded protein binds to the 3' terminal stem loop of 12S mitochondrial rRNA and is required for proper assembly of the 28S small mitochondrial ribosomal subunit. Deletion of this gene has been shown to cause mitochondrial dysfunction, growth retardation, and apoptosis. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik A T 10: 22,067,379 I234N probably benign Het
Actrt3 A G 3: 30,599,698 V51A probably damaging Het
Adgb C T 10: 10,431,281 probably null Het
AI481877 A C 4: 59,093,850 L226R probably damaging Het
Als2 A G 1: 59,211,137 S483P probably damaging Het
Ankrd10 C T 8: 11,615,682 R306H probably damaging Het
Arhgef10 T C 8: 14,975,093 probably null Het
Arhgef10 A G 8: 14,975,666 I459V probably benign Het
Armc2 C T 10: 41,966,700 probably null Het
Atp12a A G 14: 56,386,950 R952G possibly damaging Het
Atp6v1g1 A G 4: 63,550,021 Y87C probably benign Het
C030034I22Rik T A 17: 69,418,111 noncoding transcript Het
Cacna2d1 G A 5: 16,312,568 C404Y probably damaging Het
Ccdc163 T C 4: 116,741,861 silent Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Cd6 A G 19: 10,794,626 I307T possibly damaging Het
Clasrp C A 7: 19,585,240 probably benign Het
Csmd2 T C 4: 128,557,718 F113S unknown Het
Csmd3 C T 15: 47,857,924 G1437D probably damaging Het
Cyp4a14 C A 4: 115,487,301 G456W probably damaging Het
Cyp4a30b A G 4: 115,458,362 H260R possibly damaging Het
Dcp1b C T 6: 119,214,774 S217L probably benign Het
Dhx57 A T 17: 80,251,376 D1051E probably benign Het
Dmp1 A G 5: 104,212,108 S217G probably benign Het
Eif4enif1 C T 11: 3,242,586 P805S probably damaging Het
Esr1 G A 10: 4,997,890 R481H probably damaging Het
Fam19a2 A T 10: 123,704,365 H42L possibly damaging Het
Fan1 A G 7: 64,363,190 I668T probably benign Het
Gbp11 C T 5: 105,331,000 D191N probably benign Het
Gm21759 T A 5: 8,180,863 probably benign Het
Gm5454 C A 13: 103,357,523 noncoding transcript Het
Gm9874 A T 17: 30,485,789 probably benign Het
Gria2 G A 3: 80,702,492 T670I probably damaging Het
Gria4 T A 9: 4,503,614 N334I probably damaging Het
Grm5 T C 7: 87,602,722 V60A possibly damaging Het
Ift172 C T 5: 31,257,861 V1335I probably benign Het
Ino80d C T 1: 63,061,039 probably null Het
Kif1c A G 11: 70,724,081 E567G probably damaging Het
Krt31 T G 11: 100,047,873 N298T possibly damaging Het
Mapk7 C A 11: 61,490,212 probably benign Het
March8 C T 6: 116,401,145 probably benign Het
Matr3 T A 18: 35,572,296 S91R probably benign Het
Mdm1 A G 10: 118,150,942 T267A probably benign Het
Mlxip A G 5: 123,452,667 M878V probably benign Het
Mtm1 T C X: 71,296,362 probably benign Homo
Mtor T A 4: 148,540,030 M2089K probably benign Het
Mylk2 A G 2: 152,919,348 K457R probably damaging Het
Nell1 A T 7: 50,249,657 probably benign Het
Nomo1 C A 7: 46,046,937 T293N probably damaging Het
Odf3l2 G A 10: 79,645,653 T14I probably benign Het
Olfr1080 T C 2: 86,553,584 D180G possibly damaging Het
Olfr1510 T G 14: 52,410,861 T4P probably benign Het
Olfr801 A T 10: 129,669,759 C253* probably null Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Otud4 T A 8: 79,661,073 N300K possibly damaging Het
Otx1 A G 11: 21,998,681 probably benign Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Pcdhb20 A T 18: 37,505,780 Q453L possibly damaging Het
Pcdhga9 T A 18: 37,737,471 Y118N possibly damaging Het
Pes1 C A 11: 3,976,834 T372K probably benign Het
Plcl1 A T 1: 55,697,150 D550V probably benign Het
Plekhg5 T A 4: 152,107,503 C433S probably benign Het
Plin2 A G 4: 86,668,678 M1T probably null Het
Pold1 C T 7: 44,543,347 silent Het
Ppp1r7 T A 1: 93,357,863 probably null Het
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Pzp A T 6: 128,485,556 probably null Het
Rel T C 11: 23,761,129 I13V probably benign Het
Reln C T 5: 22,049,791 V527I possibly damaging Het
Retnla A G 16: 48,843,612 R90G probably benign Het
Slc39a8 T A 3: 135,886,793 probably null Het
Slc5a8 A G 10: 88,904,963 I247V probably benign Het
Son A G 16: 91,664,317 probably null Het
Spcs2 T C 7: 99,839,761 D240G probably damaging Het
St5 A T 7: 109,557,430 Y38N probably benign Het
Stx3 A T 19: 11,789,574 V91D probably damaging Het
Taf6l A G 19: 8,778,628 probably benign Het
Tbc1d8 A G 1: 39,405,317 F187S probably damaging Het
Thbs1 C G 2: 118,119,378 N611K probably damaging Het
Tipin A C 9: 64,304,327 S232R probably benign Het
Tmem132b A G 5: 125,638,268 D347G probably benign Het
Tmem161a C T 8: 70,178,915 probably benign Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Ybx3 G A 6: 131,370,413 A253V probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Zzz3 T A 3: 152,446,844 silent Het
Other mutations in Eral1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01478:Eral1 APN 11 78075732 missense probably damaging 1.00
IGL01643:Eral1 APN 11 78074278 critical splice donor site probably null
IGL02240:Eral1 APN 11 78077861 nonsense probably null
IGL03085:Eral1 APN 11 78078267 missense probably damaging 1.00
K3955:Eral1 UTSW 11 78076021 missense probably damaging 1.00
P0038:Eral1 UTSW 11 78076021 missense probably damaging 1.00
R0240:Eral1 UTSW 11 78076058 splice site probably benign
R1084:Eral1 UTSW 11 78074498 missense probably damaging 0.96
R1563:Eral1 UTSW 11 78075406 missense probably benign 0.39
R1881:Eral1 UTSW 11 78076049 missense possibly damaging 0.67
R1995:Eral1 UTSW 11 78074489 missense probably benign
R2189:Eral1 UTSW 11 78075831 missense probably benign 0.15
R2870:Eral1 UTSW 11 78076278 missense possibly damaging 0.95
R4049:Eral1 UTSW 11 78075602 missense probably damaging 1.00
R4585:Eral1 UTSW 11 78078304 missense probably damaging 1.00
R4586:Eral1 UTSW 11 78078304 missense probably damaging 1.00
R4758:Eral1 UTSW 11 78075599 missense probably benign 0.20
R5450:Eral1 UTSW 11 78078357 missense probably benign 0.23
R5613:Eral1 UTSW 11 78074404 intron probably benign
R5987:Eral1 UTSW 11 78080233 missense possibly damaging 0.90
R6048:Eral1 UTSW 11 78075783 missense probably benign 0.03
R6363:Eral1 UTSW 11 78074317 missense probably damaging 1.00
R6891:Eral1 UTSW 11 78075733 missense possibly damaging 0.76
R7384:Eral1 UTSW 11 78074101 missense possibly damaging 0.81
R7468:Eral1 UTSW 11 78075393 missense probably damaging 1.00
X0066:Eral1 UTSW 11 78075765 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGGTCAGTTCTTATGAGGAATGG -3'
(R):5'- TGCTGATATCAAAGACAGCCA -3'

Sequencing Primer
(F):5'- CTTATGAGGAATGGTAGATAAAAGGG -3'
(R):5'- TCATGACCTTCTGAAGAGCAGTCAG -3'
Posted On2015-02-18