Incidental Mutation 'R3414:Cttnbp2'
ID266729
Institutional Source Beutler Lab
Gene Symbol Cttnbp2
Ensembl Gene ENSMUSG00000000416
Gene Namecortactin binding protein 2
Synonyms4732477G22Rik, 3010022N24Rik, Cortbp2, ORF4, 9130022E09Rik
MMRRC Submission 040632-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.279) question?
Stock #R3414 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location18366478-18514843 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18389205 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1178 (V1178A)
Ref Sequence ENSEMBL: ENSMUSP00000088089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090601] [ENSMUST00000148602]
Predicted Effect probably benign
Transcript: ENSMUST00000090601
AA Change: V1178A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088089
Gene: ENSMUSG00000000416
AA Change: V1178A

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
Pfam:CortBP2 32 138 3.1e-34 PFAM
low complexity region 197 213 N/A INTRINSIC
low complexity region 255 270 N/A INTRINSIC
low complexity region 393 415 N/A INTRINSIC
low complexity region 539 547 N/A INTRINSIC
low complexity region 594 606 N/A INTRINSIC
low complexity region 662 673 N/A INTRINSIC
ANK 699 729 5.21e1 SMART
ANK 733 762 7.02e-5 SMART
ANK 766 795 6.55e-5 SMART
ANK 799 828 4.1e-6 SMART
ANK 832 861 1.09e-1 SMART
ANK 901 931 4.43e-2 SMART
Blast:AAA 1108 1285 1e-18 BLAST
low complexity region 1609 1623 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000141581
AA Change: V173A
SMART Domains Protein: ENSMUSP00000123162
Gene: ENSMUSG00000000416
AA Change: V173A

DomainStartEndE-ValueType
low complexity region 182 193 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000146775
AA Change: V668A
SMART Domains Protein: ENSMUSP00000119383
Gene: ENSMUSG00000000416
AA Change: V668A

DomainStartEndE-ValueType
low complexity region 71 79 N/A INTRINSIC
low complexity region 126 138 N/A INTRINSIC
ANK 190 220 5.21e1 SMART
ANK 224 253 7.02e-5 SMART
ANK 257 286 6.55e-5 SMART
ANK 290 319 4.1e-6 SMART
ANK 323 352 1.09e-1 SMART
ANK 392 422 4.43e-2 SMART
Blast:AAA 599 776 1e-18 BLAST
low complexity region 1100 1114 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148602
SMART Domains Protein: ENSMUSP00000118432
Gene: ENSMUSG00000000416

DomainStartEndE-ValueType
Pfam:CortBP2 26 138 4.3e-50 PFAM
Pfam:CortBP2 134 180 1.3e-12 PFAM
low complexity region 197 213 N/A INTRINSIC
low complexity region 255 270 N/A INTRINSIC
low complexity region 393 415 N/A INTRINSIC
low complexity region 539 547 N/A INTRINSIC
low complexity region 594 606 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152499
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with six ankyrin repeats and several proline-rich regions. A similar gene in rat interacts with a central regulator of the actin cytoskeleton. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,661,602 Q802L probably benign Het
Atp8b4 C A 2: 126,375,757 W613L probably damaging Het
AW554918 C A 18: 25,400,072 T261K possibly damaging Het
Ddx18 T C 1: 121,562,149 N177S probably benign Het
Dhx29 A G 13: 112,947,273 K621E probably damaging Het
Diexf A C 1: 193,128,502 S64R possibly damaging Het
Eef2 G T 10: 81,177,858 R66L probably damaging Het
Ergic2 A G 6: 148,206,681 probably benign Het
Fcna G C 2: 25,627,493 P49A probably damaging Het
Hace1 T A 10: 45,648,675 D234E possibly damaging Het
Ifi202b A G 1: 173,963,913 S400P probably benign Het
Ighv1-23 C T 12: 114,764,467 V112I probably benign Het
Il4i1 T C 7: 44,836,658 L22P probably damaging Het
Il7 G T 3: 7,576,033 Q67K probably benign Het
Inpp5d C A 1: 87,668,057 T175N possibly damaging Het
Klk1b26 A G 7: 44,016,873 I247V probably benign Het
Klrc1 A G 6: 129,677,763 probably null Het
Lama1 T C 17: 67,737,603 C166R probably damaging Het
Mrps5 A G 2: 127,596,912 D219G probably benign Het
Mtus1 T C 8: 41,048,063 T806A probably damaging Het
Naip2 G A 13: 100,189,263 R46* probably null Het
Nos2 A T 11: 78,957,588 Y1107F probably benign Het
Nsd3 T C 8: 25,700,019 I135T probably damaging Het
Olfr156 C T 4: 43,821,258 M34I probably benign Het
Olfr710 G T 7: 106,944,176 S275* probably null Het
Olfr808 A G 10: 129,768,432 H312R probably benign Het
Pla2g4f T C 2: 120,303,106 S579G probably benign Het
Ppip5k1 A T 2: 121,327,661 S252R probably damaging Het
Proc T A 18: 32,123,685 T310S probably benign Het
Psg21 A T 7: 18,652,380 L227Q probably damaging Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Sec24a T A 11: 51,729,458 N456Y probably damaging Het
Slc1a7 A G 4: 108,010,994 E497G probably benign Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Spata13 A G 14: 60,706,723 T522A probably benign Het
Top1mt T C 15: 75,657,176 N573S probably benign Het
Trim69 T C 2: 122,178,644 V395A probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Unc13b T A 4: 43,234,658 probably benign Het
Vmn1r2 T A 4: 3,172,696 M205K probably damaging Het
Zfhx4 A G 3: 5,403,823 K3014E probably damaging Het
Other mutations in Cttnbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Cttnbp2 APN 6 18381062 missense possibly damaging 0.71
IGL01014:Cttnbp2 APN 6 18423895 missense probably damaging 0.98
IGL01148:Cttnbp2 APN 6 18382818 missense probably damaging 1.00
IGL01903:Cttnbp2 APN 6 18501965 missense probably damaging 1.00
IGL01906:Cttnbp2 APN 6 18378376 nonsense probably null
IGL01994:Cttnbp2 APN 6 18420815 missense possibly damaging 0.77
IGL02212:Cttnbp2 APN 6 18382749 missense possibly damaging 0.78
IGL02696:Cttnbp2 APN 6 18434129 missense probably benign 0.01
IGL02813:Cttnbp2 APN 6 18367538 missense possibly damaging 0.94
IGL02864:Cttnbp2 APN 6 18374549 missense probably benign 0.21
IGL03309:Cttnbp2 APN 6 18381036 missense probably damaging 0.98
FR4304:Cttnbp2 UTSW 6 18367458 utr 3 prime probably benign
FR4449:Cttnbp2 UTSW 6 18367462 utr 3 prime probably benign
FR4548:Cttnbp2 UTSW 6 18367463 utr 3 prime probably benign
FR4589:Cttnbp2 UTSW 6 18367458 utr 3 prime probably benign
FR4976:Cttnbp2 UTSW 6 18367461 utr 3 prime probably benign
FR4976:Cttnbp2 UTSW 6 18367467 utr 3 prime probably benign
R0165:Cttnbp2 UTSW 6 18435410 nonsense probably null
R0382:Cttnbp2 UTSW 6 18435343 missense probably benign 0.39
R0464:Cttnbp2 UTSW 6 18408691 missense possibly damaging 0.81
R0550:Cttnbp2 UTSW 6 18435309 missense possibly damaging 0.89
R0571:Cttnbp2 UTSW 6 18381103 missense probably benign
R0627:Cttnbp2 UTSW 6 18367373 makesense probably null
R0788:Cttnbp2 UTSW 6 18423835 missense probably damaging 1.00
R0826:Cttnbp2 UTSW 6 18405178 splice site probably benign
R1319:Cttnbp2 UTSW 6 18434630 missense probably benign 0.00
R1476:Cttnbp2 UTSW 6 18434221 missense probably damaging 1.00
R1572:Cttnbp2 UTSW 6 18375975 missense possibly damaging 0.68
R1596:Cttnbp2 UTSW 6 18408592 missense probably damaging 1.00
R1607:Cttnbp2 UTSW 6 18435433 missense probably damaging 1.00
R1633:Cttnbp2 UTSW 6 18435167 missense probably damaging 1.00
R1634:Cttnbp2 UTSW 6 18408657 missense probably benign 0.39
R1661:Cttnbp2 UTSW 6 18434983 missense probably benign 0.20
R1665:Cttnbp2 UTSW 6 18434983 missense probably benign 0.20
R1834:Cttnbp2 UTSW 6 18501966 missense probably damaging 1.00
R1853:Cttnbp2 UTSW 6 18408602 missense probably benign 0.00
R1855:Cttnbp2 UTSW 6 18378413 missense probably benign
R2018:Cttnbp2 UTSW 6 18434518 missense probably damaging 1.00
R2169:Cttnbp2 UTSW 6 18426097 missense probably benign 0.00
R2175:Cttnbp2 UTSW 6 18434829 unclassified probably null
R2202:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2203:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2204:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2205:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2371:Cttnbp2 UTSW 6 18380604 missense possibly damaging 0.69
R2416:Cttnbp2 UTSW 6 18448286 missense probably damaging 0.99
R3617:Cttnbp2 UTSW 6 18414190 missense probably damaging 1.00
R3861:Cttnbp2 UTSW 6 18423833 missense probably benign 0.11
R3862:Cttnbp2 UTSW 6 18434906 missense probably benign 0.02
R3940:Cttnbp2 UTSW 6 18420975 missense probably benign 0.34
R3941:Cttnbp2 UTSW 6 18427453 missense probably benign 0.11
R4097:Cttnbp2 UTSW 6 18420872 missense probably benign
R4211:Cttnbp2 UTSW 6 18427543 missense probably damaging 1.00
R4353:Cttnbp2 UTSW 6 18514704 missense probably benign 0.00
R4367:Cttnbp2 UTSW 6 18405249 missense probably damaging 1.00
R4651:Cttnbp2 UTSW 6 18434038 missense possibly damaging 0.81
R4652:Cttnbp2 UTSW 6 18434038 missense possibly damaging 0.81
R4660:Cttnbp2 UTSW 6 18406537 missense probably benign 0.05
R4975:Cttnbp2 UTSW 6 18406526 missense possibly damaging 0.91
R5064:Cttnbp2 UTSW 6 18448279 missense probably damaging 1.00
R5205:Cttnbp2 UTSW 6 18427433 splice site probably benign
R5305:Cttnbp2 UTSW 6 18381098 missense probably benign
R5484:Cttnbp2 UTSW 6 18427690 intron probably benign
R5629:Cttnbp2 UTSW 6 18405218 missense probably damaging 1.00
R5763:Cttnbp2 UTSW 6 18414299 missense probably benign 0.00
R5766:Cttnbp2 UTSW 6 18381033 missense possibly damaging 0.87
R5942:Cttnbp2 UTSW 6 18448440 missense probably damaging 1.00
R6073:Cttnbp2 UTSW 6 18434233 missense probably damaging 1.00
R6073:Cttnbp2 UTSW 6 18448369 missense probably benign 0.01
R6163:Cttnbp2 UTSW 6 18434951 missense possibly damaging 0.91
R6545:Cttnbp2 UTSW 6 18405279 intron probably null
R6858:Cttnbp2 UTSW 6 18448453 missense probably damaging 1.00
R7037:Cttnbp2 UTSW 6 18435118 missense probably damaging 1.00
R7135:Cttnbp2 UTSW 6 18448447 missense possibly damaging 0.95
R7141:Cttnbp2 UTSW 6 18380468 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACACAGGCTGGCTGCTTAG -3'
(R):5'- CAGCATTTTCAGAGCATGCC -3'

Sequencing Primer
(F):5'- GCTGCTTAGCCTGTTCCC -3'
(R):5'- AACTCCAGCTTGTGTCAAGTTG -3'
Posted On2015-02-18