Incidental Mutation 'R3415:Exoc6b'
ID266761
Institutional Source Beutler Lab
Gene Symbol Exoc6b
Ensembl Gene ENSMUSG00000033769
Gene Nameexocyst complex component 6B
SynonymsSec15b, Sec15l2, 4930569O18Rik, G430127E12Rik
MMRRC Submission 040633-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.697) question?
Stock #R3415 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location84618487-85069513 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 84890565 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 288 (L288F)
Ref Sequence ENSEMBL: ENSMUSP00000125312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160197] [ENSMUST00000162821]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000046334
Predicted Effect noncoding transcript
Transcript: ENSMUST00000051531
Predicted Effect possibly damaging
Transcript: ENSMUST00000160197
AA Change: L288F

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125312
Gene: ENSMUSG00000033769
AA Change: L288F

DomainStartEndE-ValueType
coiled coil region 79 118 N/A INTRINSIC
low complexity region 272 282 N/A INTRINSIC
Pfam:Sec15 464 770 4.5e-105 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162821
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204011
Meta Mutation Damage Score 0.0556 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is a part of the evolutionarily conserved exocyst, a multimeric protein complex necessary for exocytosis, which in turn, is crucial for cell growth, polarity and migration. Disruption of this gene may be associated with phenotypes exhibiting multiple symptoms including intellectual disability and developmental delay (DD). [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc39 C G 3: 33,814,497 L813F probably benign Het
Cdh13 A T 8: 118,675,207 D116V probably benign Het
Cep170 G T 1: 176,756,044 P923Q probably damaging Het
Chga A G 12: 102,562,784 E340G probably benign Het
Cmip T A 8: 117,349,377 probably null Het
Cnga4 A G 7: 105,407,118 Y309C probably damaging Het
Crocc G A 4: 141,046,447 T103I possibly damaging Het
Dph6 C T 2: 114,518,287 V267I probably benign Het
Ero1l T C 14: 45,287,866 T401A possibly damaging Het
Gm884 A T 11: 103,614,609 S2178T possibly damaging Het
Ifi203 G A 1: 173,928,760 R486* probably null Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Klhl42 G A 6: 147,107,880 V406M probably damaging Het
Lims2 A T 18: 31,944,155 Y58F probably damaging Het
Lrp12 A G 15: 39,878,282 F365L probably damaging Het
Mark4 T C 7: 19,451,725 D28G probably benign Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mmp1a A T 9: 7,464,869 K34N possibly damaging Het
Olfr730 T A 14: 50,186,612 T202S possibly damaging Het
P2rx5 G T 11: 73,160,660 V22L possibly damaging Het
Pnmal1 A G 7: 16,960,954 R245G possibly damaging Het
Prpsap1 T C 11: 116,478,584 S179G probably benign Het
Specc1 A G 11: 62,118,419 T334A probably benign Het
Tas2r124 A T 6: 132,755,638 R303S probably benign Het
Tm7sf2 A G 19: 6,063,599 Y301H probably damaging Het
Unc13c G T 9: 73,932,586 H328N probably benign Het
Zfp641 T C 15: 98,290,540 D153G probably benign Het
Zp3 A G 5: 135,985,660 T278A probably benign Het
Zscan2 T A 7: 80,875,402 S290R probably damaging Het
Other mutations in Exoc6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Exoc6b APN 6 84989453 missense probably benign 0.08
IGL01148:Exoc6b APN 6 84908226 missense probably benign 0.18
IGL01804:Exoc6b APN 6 84908166 missense probably damaging 0.98
IGL01817:Exoc6b APN 6 85069338 missense probably damaging 1.00
IGL01912:Exoc6b APN 6 84625174 missense probably damaging 1.00
IGL02441:Exoc6b APN 6 85005008 missense probably damaging 1.00
IGL02947:Exoc6b APN 6 84858429 missense probably benign
IGL02996:Exoc6b APN 6 84908213 missense probably benign 0.01
IGL03132:Exoc6b APN 6 84791264 missense possibly damaging 0.46
IGL03338:Exoc6b APN 6 84844130 missense probably damaging 0.99
R0003:Exoc6b UTSW 6 84854699 critical splice donor site probably null
R0732:Exoc6b UTSW 6 84855522 missense probably damaging 0.99
R1137:Exoc6b UTSW 6 84908223 missense probably benign
R1381:Exoc6b UTSW 6 84835117 missense probably benign
R1723:Exoc6b UTSW 6 85069344 missense probably damaging 1.00
R1838:Exoc6b UTSW 6 84853678 missense probably benign 0.04
R1866:Exoc6b UTSW 6 84851914 missense probably damaging 0.99
R2122:Exoc6b UTSW 6 84621482 missense probably benign 0.01
R2138:Exoc6b UTSW 6 84989482 missense probably damaging 1.00
R2357:Exoc6b UTSW 6 84989339 missense possibly damaging 0.60
R2987:Exoc6b UTSW 6 84851947 missense probably damaging 0.96
R2988:Exoc6b UTSW 6 84851947 missense probably damaging 0.96
R3417:Exoc6b UTSW 6 84890565 missense possibly damaging 0.81
R4364:Exoc6b UTSW 6 85003179 intron probably benign
R4610:Exoc6b UTSW 6 85003159 intron probably benign
R4624:Exoc6b UTSW 6 84854809 splice site probably benign
R4845:Exoc6b UTSW 6 84835137 missense probably benign 0.04
R5366:Exoc6b UTSW 6 84890531 missense probably benign
R5603:Exoc6b UTSW 6 84835144 missense possibly damaging 0.96
R5635:Exoc6b UTSW 6 84851927 missense probably damaging 0.99
R5728:Exoc6b UTSW 6 84860191 missense probably damaging 1.00
R6188:Exoc6b UTSW 6 84855497 missense probably damaging 0.99
R7030:Exoc6b UTSW 6 84848825 missense probably damaging 0.99
R7058:Exoc6b UTSW 6 84854722 missense probably damaging 1.00
R7259:Exoc6b UTSW 6 84848810 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- CAAGAGCAGAGGAATTAGTTAATACTC -3'
(R):5'- GCCACCTGTACTCTGTCAGC -3'

Sequencing Primer
(F):5'- ACTCGCTAAACAATACTTTGCTC -3'
(R):5'- CAAGCACTCTTAATTGGGGAGTC -3'
Posted On2015-02-18