Incidental Mutation 'R3418:Myof'
ID266933
Institutional Source Beutler Lab
Gene Symbol Myof
Ensembl Gene ENSMUSG00000048612
Gene Namemyoferlin
SynonymsFer1l3, E030042N20Rik, 2310051D19Rik
MMRRC Submission 040636-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3418 (G1)
Quality Score188
Status Validated
Chromosome19
Chromosomal Location37899036-38043577 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37922978 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1502 (S1502P)
Ref Sequence ENSEMBL: ENSMUSP00000129792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041475] [ENSMUST00000172095] [ENSMUST00000225159] [ENSMUST00000226068]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041475
AA Change: S1502P

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000045036
Gene: ENSMUSG00000048612
AA Change: S1502P

DomainStartEndE-ValueType
C2 1 100 7.56e-16 SMART
low complexity region 142 159 N/A INTRINSIC
C2 200 299 4.03e-11 SMART
FerI 282 353 2.76e-37 SMART
C2 359 473 2.93e-13 SMART
low complexity region 532 543 N/A INTRINSIC
FerA 663 728 5.07e-27 SMART
FerB 755 829 2.39e-46 SMART
DysFN 843 901 6.42e-21 SMART
DysFN 914 970 1.16e-18 SMART
DysFC 979 1017 1.04e-11 SMART
DysFC 1037 1070 1.62e-8 SMART
C2 1127 1234 5.03e-12 SMART
C2 1289 1396 1.15e1 SMART
low complexity region 1425 1436 N/A INTRINSIC
low complexity region 1515 1526 N/A INTRINSIC
C2 1541 1640 2.66e-11 SMART
C2 1776 1905 2.81e-1 SMART
Pfam:Ferlin_C 1939 2043 2.4e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172095
AA Change: S1502P

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129792
Gene: ENSMUSG00000048612
AA Change: S1502P

DomainStartEndE-ValueType
C2 1 100 7.56e-16 SMART
low complexity region 142 159 N/A INTRINSIC
C2 200 299 4.03e-11 SMART
FerI 282 353 2.76e-37 SMART
C2 359 473 2.93e-13 SMART
low complexity region 532 543 N/A INTRINSIC
FerA 663 728 5.07e-27 SMART
FerB 755 829 2.39e-46 SMART
DysFN 843 901 6.42e-21 SMART
DysFN 914 970 1.16e-18 SMART
DysFC 979 1017 1.04e-11 SMART
DysFC 1037 1070 1.62e-8 SMART
C2 1127 1234 5.03e-12 SMART
C2 1289 1396 1.15e1 SMART
low complexity region 1515 1526 N/A INTRINSIC
C2 1541 1640 2.66e-11 SMART
C2 1776 1905 2.81e-1 SMART
transmembrane domain 2013 2035 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224518
Predicted Effect probably benign
Transcript: ENSMUST00000225159
Predicted Effect probably benign
Transcript: ENSMUST00000226068
AA Change: S1515P

PolyPhen 2 Score 0.240 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.136 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the ferlin family of proteins, which have been implicated in fusion events in muscle tissue. Members of this family have a carboxy-terminal single pass transmembrane domain and multiple C2 domains, which bind negatively charged phospholipids in the presence of calcium ions. This gene is expressed at high levels in myoblasts and upregulated in damaged skeletal muscle. Mice deficient in this protein display defects in myoblast fusion, muscle regeneration, and angiogenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body size, impaired myogenesis, lack of large diameter myofibers, abnormal skeletal muscle regeneration after injury, and decreased vascular permeability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530400C23Rik A G 6: 133,294,119 Q42R probably benign Het
Acaa1a A G 9: 119,349,490 probably null Het
Agbl5 T C 5: 30,904,723 S756P probably damaging Het
Armc9 T C 1: 86,194,338 L395P probably damaging Het
Cdc16 C T 8: 13,769,489 Q362* probably null Het
Cdh5 C T 8: 104,129,370 R312C probably damaging Het
Cep170b C T 12: 112,738,468 Q887* probably null Het
Chd9 T C 8: 91,036,591 I2348T probably damaging Het
Clec9a A G 6: 129,421,038 probably benign Het
Col6a3 T C 1: 90,804,091 D873G probably benign Het
D130040H23Rik T C 8: 69,302,927 I328T probably benign Het
Dido1 G T 2: 180,660,935 D1725E possibly damaging Het
Dnajb14 A G 3: 137,892,870 D123G probably null Het
Dock2 A T 11: 34,689,760 M661K probably damaging Het
Esam C T 9: 37,537,130 probably null Het
Fam20c A T 5: 138,757,868 N220Y probably damaging Het
Fat2 G T 11: 55,278,998 H2978Q probably benign Het
Fbn1 T C 2: 125,320,926 T2147A possibly damaging Het
Fdft1 T C 14: 63,156,621 T214A probably damaging Het
Fhl5 T C 4: 25,211,252 S147G probably benign Het
Flrt2 A G 12: 95,780,604 Y572C probably damaging Het
Gcat A T 15: 79,042,097 T56S possibly damaging Het
Gemin5 A T 11: 58,156,628 probably null Het
Gm4736 A T 6: 132,115,677 noncoding transcript Het
Grin2b T C 6: 135,843,110 N368S probably benign Het
Gsto1 T C 19: 47,857,905 F64L probably benign Het
Gucy1a1 A G 3: 82,106,133 S401P probably damaging Het
Htr1f G A 16: 64,925,897 P344L probably damaging Het
Ighv7-3 T A 12: 114,153,299 Y81F probably damaging Het
Jakmip3 C A 7: 139,017,745 probably benign Het
Kcnj13 T C 1: 87,386,919 T194A probably benign Het
Khdrbs3 T C 15: 69,049,375 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lyn A T 4: 3,746,833 I204F probably damaging Het
Mbd6 C G 10: 127,286,503 R152P probably null Het
Myom2 T G 8: 15,085,294 I499S probably benign Het
Nos2 T A 11: 78,959,695 F1126L possibly damaging Het
Olfr399 G A 11: 74,053,988 T257I probably damaging Het
P2ry1 T C 3: 61,003,712 F91L probably damaging Het
Pcdh15 C A 10: 74,584,222 D1166E probably benign Het
Pou6f1 C A 15: 100,580,924 V368L probably benign Het
Ptcd3 A T 6: 71,883,486 I579K possibly damaging Het
Rbm45 A G 2: 76,379,018 E392G probably damaging Het
Rnf168 A G 16: 32,299,192 N524D probably benign Het
Rnf222 G T 11: 68,893,156 R183L probably damaging Het
Robo1 C T 16: 73,035,917 T1526I probably benign Het
Sel1l A G 12: 91,810,002 W689R probably damaging Het
Serpinb13 T C 1: 106,998,927 S218P probably damaging Het
Serpini1 A G 3: 75,640,282 Y367C probably damaging Het
Slc13a2 A G 11: 78,400,840 F329S probably benign Het
Smc2 T C 4: 52,476,850 probably benign Het
Sycp2 A T 2: 178,401,653 probably benign Het
Tab2 G A 10: 7,907,481 P679L probably damaging Het
Tdrd1 T A 19: 56,831,231 N54K possibly damaging Het
Tgfbr2 T C 9: 116,129,833 Y146C probably damaging Het
Tnfrsf11a A G 1: 105,809,405 D79G possibly damaging Het
Trpa1 T C 1: 14,874,381 I1046M probably benign Het
Ubn1 A G 16: 5,074,379 probably benign Het
Ubp1 T C 9: 113,951,686 probably null Het
Vmn2r2 A T 3: 64,116,899 F754I probably benign Het
Other mutations in Myof
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Myof APN 19 37960934 missense probably benign 0.16
IGL00764:Myof APN 19 37974923 missense probably benign 0.04
IGL00801:Myof APN 19 37986073 missense probably damaging 0.99
IGL01084:Myof APN 19 37936436 missense probably damaging 1.00
IGL01368:Myof APN 19 37936457 missense probably damaging 0.97
IGL01472:Myof APN 19 37923076 missense probably benign
IGL01785:Myof APN 19 37980423 nonsense probably null
IGL02205:Myof APN 19 37924635 missense probably damaging 1.00
IGL02268:Myof APN 19 37954429 missense possibly damaging 0.50
IGL02268:Myof APN 19 37974863 missense possibly damaging 0.90
IGL02339:Myof APN 19 37972213 missense possibly damaging 0.46
IGL02433:Myof APN 19 37972193 missense probably benign 0.05
IGL02481:Myof APN 19 37937913 nonsense probably null
IGL02536:Myof APN 19 37949655 missense probably damaging 0.97
IGL02682:Myof APN 19 37921481 missense probably benign 0.09
IGL02732:Myof APN 19 37977716 missense possibly damaging 0.50
IGL02887:Myof APN 19 37920779 critical splice acceptor site probably null
IGL03114:Myof APN 19 37903861 missense probably damaging 1.00
IGL03137:Myof APN 19 37974889 missense probably damaging 1.00
IGL03340:Myof APN 19 37911159 missense probably damaging 1.00
PIT4791001:Myof UTSW 19 37982958 critical splice donor site probably null
R0024:Myof UTSW 19 37915740 missense probably damaging 0.98
R0140:Myof UTSW 19 37951556 nonsense probably null
R0309:Myof UTSW 19 37981266 missense probably benign 0.12
R0330:Myof UTSW 19 37935878 missense probably damaging 1.00
R0345:Myof UTSW 19 38024345 missense probably damaging 1.00
R0349:Myof UTSW 19 37910969 missense probably damaging 0.99
R0463:Myof UTSW 19 37916504 missense probably damaging 1.00
R0507:Myof UTSW 19 37901277 missense possibly damaging 0.94
R0512:Myof UTSW 19 37954524 missense possibly damaging 0.54
R0608:Myof UTSW 19 37916504 missense probably damaging 1.00
R0723:Myof UTSW 19 37981260 missense probably damaging 1.00
R1081:Myof UTSW 19 37986088 missense probably damaging 0.99
R1196:Myof UTSW 19 37910960 missense probably damaging 1.00
R1243:Myof UTSW 19 37936092 missense probably damaging 1.00
R1371:Myof UTSW 19 37903668 splice site probably benign
R1381:Myof UTSW 19 37995485 missense probably damaging 1.00
R1419:Myof UTSW 19 37901911 missense probably damaging 1.00
R1527:Myof UTSW 19 37924619 missense probably damaging 1.00
R1672:Myof UTSW 19 37943479 missense probably damaging 1.00
R1864:Myof UTSW 19 37986705 missense probably benign
R1914:Myof UTSW 19 37977693 missense probably damaging 1.00
R1915:Myof UTSW 19 37977693 missense probably damaging 1.00
R1970:Myof UTSW 19 37945634 missense probably damaging 0.99
R2062:Myof UTSW 19 37915746 missense possibly damaging 0.94
R2144:Myof UTSW 19 37981221 critical splice donor site probably null
R2243:Myof UTSW 19 37901319 missense probably damaging 1.00
R2339:Myof UTSW 19 37937927 missense probably damaging 1.00
R2484:Myof UTSW 19 37903843 missense probably benign 0.13
R2880:Myof UTSW 19 37923025 missense probably benign 0.04
R3967:Myof UTSW 19 37901263 missense probably damaging 1.00
R3967:Myof UTSW 19 38022610 missense possibly damaging 0.59
R3970:Myof UTSW 19 37901263 missense probably damaging 1.00
R3970:Myof UTSW 19 38022610 missense possibly damaging 0.59
R4238:Myof UTSW 19 37923008 nonsense probably null
R4405:Myof UTSW 19 37922978 missense probably damaging 0.97
R4406:Myof UTSW 19 37922978 missense probably damaging 0.97
R4407:Myof UTSW 19 37922978 missense probably damaging 0.97
R4408:Myof UTSW 19 37922978 missense probably damaging 0.97
R4561:Myof UTSW 19 37922990 missense probably benign
R4606:Myof UTSW 19 37967099 missense probably damaging 1.00
R4778:Myof UTSW 19 37949563 missense probably damaging 1.00
R4801:Myof UTSW 19 37945738 missense probably benign 0.24
R4802:Myof UTSW 19 37945738 missense probably benign 0.24
R4812:Myof UTSW 19 37916559 missense probably damaging 1.00
R4884:Myof UTSW 19 37942357 missense probably damaging 1.00
R4964:Myof UTSW 19 37935852 missense probably damaging 0.97
R4966:Myof UTSW 19 37935852 missense probably damaging 0.97
R5069:Myof UTSW 19 37905325 missense possibly damaging 0.65
R5181:Myof UTSW 19 37932623 missense possibly damaging 0.95
R5376:Myof UTSW 19 37916400 missense probably damaging 1.00
R5384:Myof UTSW 19 37952987 missense probably damaging 0.98
R5543:Myof UTSW 19 37981330 missense probably benign 0.00
R5626:Myof UTSW 19 37922990 missense probably benign
R5865:Myof UTSW 19 37910934 missense probably damaging 1.00
R5919:Myof UTSW 19 38024370 missense possibly damaging 0.95
R5924:Myof UTSW 19 37982973 missense probably damaging 0.97
R5997:Myof UTSW 19 37905299 missense possibly damaging 0.90
R5999:Myof UTSW 19 37939856 nonsense probably null
R6039:Myof UTSW 19 37977684 missense probably damaging 1.00
R6039:Myof UTSW 19 37977684 missense probably damaging 1.00
R6041:Myof UTSW 19 37924620 missense probably damaging 1.00
R6051:Myof UTSW 19 38024361 missense probably damaging 1.00
R6057:Myof UTSW 19 37926981 critical splice donor site probably null
R6089:Myof UTSW 19 37967060 missense probably benign 0.37
R6195:Myof UTSW 19 37913357 missense possibly damaging 0.89
R6478:Myof UTSW 19 37903831 missense probably damaging 1.00
R6545:Myof UTSW 19 37942297 missense possibly damaging 0.67
R6655:Myof UTSW 19 37934791 missense probably damaging 1.00
R6715:Myof UTSW 19 37968346 missense probably benign 0.04
R6737:Myof UTSW 19 37943514 missense probably benign 0.01
R6837:Myof UTSW 19 37922956 critical splice donor site probably null
R7096:Myof UTSW 19 37936200 missense probably damaging 1.00
R7308:Myof UTSW 19 37910911 missense probably damaging 0.98
X0024:Myof UTSW 19 37974597 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- GCAATATCCTGACTCCCCTG -3'
(R):5'- AGTTCTATGCTGCACCCGTG -3'

Sequencing Primer
(F):5'- CCCTGGGGGCATTTTCC -3'
(R):5'- GCCCCAGGAGTTCTGTCCAATC -3'
Posted On2015-02-18