Incidental Mutation 'R3421:Olfr1230'
ID267029
Institutional Source Beutler Lab
Gene Symbol Olfr1230
Ensembl Gene ENSMUSG00000075094
Gene Nameolfactory receptor 1230
SynonymsGA_x6K02T2Q125-50741934-50741017, MOR237-1
MMRRC Submission 040639-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R3421 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89296351-89297268 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 89296553 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 239 (S239T)
Ref Sequence ENSEMBL: ENSMUSP00000097375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099787] [ENSMUST00000216144]
Predicted Effect probably benign
Transcript: ENSMUST00000099787
AA Change: S239T

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000097375
Gene: ENSMUSG00000075094
AA Change: S239T

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 5.7e-44 PFAM
Pfam:7tm_1 39 285 6.8e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216144
Meta Mutation Damage Score 0.1264 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T A 5: 114,212,636 probably null Het
Agbl3 A G 6: 34,793,965 T132A probably benign Het
Amn1 A T 6: 149,169,452 L196* probably null Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Armc4 T C 18: 7,223,523 probably benign Het
Atp7b C T 8: 22,028,670 D51N probably damaging Het
Brip1 A T 11: 86,152,669 Y356* probably null Het
Ccdc40 C T 11: 119,234,779 P348L probably benign Het
Chrdl2 G A 7: 100,023,868 C9Y probably damaging Het
Chst4 T C 8: 110,030,406 D192G probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
D930048N14Rik T C 11: 51,654,958 *226R probably null Het
Dmgdh T C 13: 93,711,361 V522A probably benign Het
Dtx2 T A 5: 136,012,478 Y246N probably damaging Het
Fam19a1 C A 6: 96,649,138 D112E probably damaging Het
Gtf2ird1 T A 5: 134,388,500 M518L probably benign Het
Hoxc6 T A 15: 103,010,895 W188R probably damaging Het
Igfn1 C T 1: 135,976,917 probably null Het
Kcnip1 A G 11: 33,645,594 V43A probably damaging Het
Kif4-ps A T 12: 101,146,971 E453V probably damaging Het
Kifap3 T A 1: 163,794,026 I81N probably damaging Het
Mgat4d T C 8: 83,358,143 S172P probably damaging Het
Mr1 T C 1: 155,137,591 Y80C probably damaging Het
Nuak2 A G 1: 132,332,080 D532G probably benign Het
Olfr1288 A G 2: 111,478,952 H56R probably benign Het
Olfr20 A G 11: 73,354,634 N294D probably damaging Het
Olfr26 A G 9: 38,855,325 K88E possibly damaging Het
Olfr725 T C 14: 50,034,540 T288A possibly damaging Het
Pik3cg A T 12: 32,204,739 F416L probably damaging Het
Prex1 A G 2: 166,617,854 V124A probably damaging Het
Psmb2 T C 4: 126,677,837 M28T probably damaging Het
Ric1 T C 19: 29,567,590 I230T probably damaging Het
Saysd1 T A 14: 20,082,926 K54N probably benign Het
Slc25a17 C T 15: 81,360,700 V11I probably benign Het
Slc5a4a T C 10: 76,176,573 V359A probably benign Het
Slc7a3 T A X: 101,080,875 probably benign Het
Slco1a5 A T 6: 142,268,238 D52E possibly damaging Het
Soat2 T C 15: 102,156,809 probably benign Het
Telo2 C T 17: 25,110,752 R262Q probably damaging Het
Zdhhc14 T A 17: 5,753,091 *490R probably null Het
Zfp217 A G 2: 170,120,017 F130S possibly damaging Het
Zfp712 C T 13: 67,052,392 V10M probably damaging Het
Other mutations in Olfr1230
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Olfr1230 APN 2 89296455 missense probably benign 0.40
IGL01419:Olfr1230 APN 2 89296345 unclassified probably benign
IGL01644:Olfr1230 APN 2 89296632 missense probably benign 0.01
IGL01653:Olfr1230 APN 2 89297127 missense probably benign 0.08
IGL01674:Olfr1230 APN 2 89296670 missense probably damaging 1.00
IGL02124:Olfr1230 APN 2 89297063 missense probably benign 0.01
IGL03053:Olfr1230 APN 2 89296445 missense probably damaging 0.97
R0504:Olfr1230 UTSW 2 89296739 missense probably damaging 0.99
R1473:Olfr1230 UTSW 2 89296906 nonsense probably null
R1742:Olfr1230 UTSW 2 89296424 missense probably damaging 1.00
R1899:Olfr1230 UTSW 2 89296670 missense probably damaging 1.00
R1900:Olfr1230 UTSW 2 89296670 missense probably damaging 1.00
R1945:Olfr1230 UTSW 2 89296784 missense probably damaging 1.00
R2935:Olfr1230 UTSW 2 89297260 missense possibly damaging 0.69
R5185:Olfr1230 UTSW 2 89296387 missense probably benign
R5377:Olfr1230 UTSW 2 89297162 missense probably damaging 0.99
R5400:Olfr1230 UTSW 2 89296913 missense probably damaging 1.00
R6083:Olfr1230 UTSW 2 89297024 missense probably damaging 1.00
R6086:Olfr1230 UTSW 2 89296854 missense probably damaging 1.00
R6155:Olfr1230 UTSW 2 89296421 missense probably damaging 1.00
R6218:Olfr1230 UTSW 2 89296962 missense probably damaging 0.98
R6361:Olfr1230 UTSW 2 89296646 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCAGAGCATGTTTCACTTCTGC -3'
(R):5'- ATACCTTTCTGTGGTCCCAATG -3'

Sequencing Primer
(F):5'- AGAGCATGTTTCACTTCTGCATTTC -3'
(R):5'- GGTCCCAATGTCATTGATCATG -3'
Posted On2015-02-18