Incidental Mutation 'R3421:Olfr1288'
ID267030
Institutional Source Beutler Lab
Gene Symbol Olfr1288
Ensembl Gene ENSMUSG00000044039
Gene Nameolfactory receptor 1288
SynonymsMOR245-9, GA_x6K02T2Q125-72530279-72531217
MMRRC Submission 040639-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R3421 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location111474101-111479994 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111478952 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 56 (H56R)
Ref Sequence ENSEMBL: ENSMUSP00000150331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104889] [ENSMUST00000120021] [ENSMUST00000207494] [ENSMUST00000214816]
Predicted Effect probably benign
Transcript: ENSMUST00000104889
AA Change: H56R

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000100485
Gene: ENSMUSG00000044039
AA Change: H56R

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 1.3e-43 PFAM
Pfam:7tm_1 41 287 2.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120021
Predicted Effect probably benign
Transcript: ENSMUST00000207494
Predicted Effect probably benign
Transcript: ENSMUST00000214816
AA Change: H56R

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225425
Meta Mutation Damage Score 0.15 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T A 5: 114,212,636 probably null Het
Agbl3 A G 6: 34,793,965 T132A probably benign Het
Amn1 A T 6: 149,169,452 L196* probably null Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Armc4 T C 18: 7,223,523 probably benign Het
Atp7b C T 8: 22,028,670 D51N probably damaging Het
Brip1 A T 11: 86,152,669 Y356* probably null Het
Ccdc40 C T 11: 119,234,779 P348L probably benign Het
Chrdl2 G A 7: 100,023,868 C9Y probably damaging Het
Chst4 T C 8: 110,030,406 D192G probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
D930048N14Rik T C 11: 51,654,958 *226R probably null Het
Dmgdh T C 13: 93,711,361 V522A probably benign Het
Dtx2 T A 5: 136,012,478 Y246N probably damaging Het
Fam19a1 C A 6: 96,649,138 D112E probably damaging Het
Gtf2ird1 T A 5: 134,388,500 M518L probably benign Het
Hoxc6 T A 15: 103,010,895 W188R probably damaging Het
Igfn1 C T 1: 135,976,917 probably null Het
Kcnip1 A G 11: 33,645,594 V43A probably damaging Het
Kif4-ps A T 12: 101,146,971 E453V probably damaging Het
Kifap3 T A 1: 163,794,026 I81N probably damaging Het
Mgat4d T C 8: 83,358,143 S172P probably damaging Het
Mr1 T C 1: 155,137,591 Y80C probably damaging Het
Nuak2 A G 1: 132,332,080 D532G probably benign Het
Olfr1230 C G 2: 89,296,553 S239T probably benign Het
Olfr20 A G 11: 73,354,634 N294D probably damaging Het
Olfr26 A G 9: 38,855,325 K88E possibly damaging Het
Olfr725 T C 14: 50,034,540 T288A possibly damaging Het
Pik3cg A T 12: 32,204,739 F416L probably damaging Het
Prex1 A G 2: 166,617,854 V124A probably damaging Het
Psmb2 T C 4: 126,677,837 M28T probably damaging Het
Ric1 T C 19: 29,567,590 I230T probably damaging Het
Saysd1 T A 14: 20,082,926 K54N probably benign Het
Slc25a17 C T 15: 81,360,700 V11I probably benign Het
Slc5a4a T C 10: 76,176,573 V359A probably benign Het
Slc7a3 T A X: 101,080,875 probably benign Het
Slco1a5 A T 6: 142,268,238 D52E possibly damaging Het
Soat2 T C 15: 102,156,809 probably benign Het
Telo2 C T 17: 25,110,752 R262Q probably damaging Het
Zdhhc14 T A 17: 5,753,091 *490R probably null Het
Zfp217 A G 2: 170,120,017 F130S possibly damaging Het
Zfp712 C T 13: 67,052,392 V10M probably damaging Het
Other mutations in Olfr1288
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01800:Olfr1288 APN 2 111478864 missense probably benign
IGL02021:Olfr1288 APN 2 111479480 missense probably benign 0.03
IGL02061:Olfr1288 APN 2 111479269 missense possibly damaging 0.94
R2016:Olfr1288 UTSW 2 111479187 missense probably benign 0.00
R2017:Olfr1288 UTSW 2 111479187 missense probably benign 0.00
R2848:Olfr1288 UTSW 2 111479354 missense probably benign 0.00
R2849:Olfr1288 UTSW 2 111479354 missense probably benign 0.00
R4223:Olfr1288 UTSW 2 111479144 missense probably benign 0.00
R4432:Olfr1288 UTSW 2 111479412 nonsense probably null
R4433:Olfr1288 UTSW 2 111479412 nonsense probably null
R4476:Olfr1288 UTSW 2 111479664 missense possibly damaging 0.58
R4631:Olfr1288 UTSW 2 111479563 missense probably damaging 1.00
R6029:Olfr1288 UTSW 2 111478965 nonsense probably null
R6036:Olfr1288 UTSW 2 111478988 missense probably damaging 1.00
R6036:Olfr1288 UTSW 2 111478988 missense probably damaging 1.00
R6084:Olfr1288 UTSW 2 111479389 missense probably damaging 1.00
R6329:Olfr1288 UTSW 2 111479228 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGATCCAATGGACCAAGTTAATGC -3'
(R):5'- TAGTGAAGAGGCTTGCAGATTG -3'

Sequencing Primer
(F):5'- GGACCAAGTTAATGCTTCTGC -3'
(R):5'- TCATATGCCATGGCTATGAGC -3'
Posted On2015-02-18