Incidental Mutation 'R3421:Zfp217'
ID267032
Institutional Source Beutler Lab
Gene Symbol Zfp217
Ensembl Gene ENSMUSG00000052056
Gene Namezinc finger protein 217
Synonyms4933431C08Rik
MMRRC Submission 040639-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.818) question?
Stock #R3421 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location170108643-170148103 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 170120017 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 130 (F130S)
Ref Sequence ENSEMBL: ENSMUSP00000104783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063710] [ENSMUST00000109155]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063710
AA Change: F130S

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000067334
Gene: ENSMUSG00000052056
AA Change: F130S

DomainStartEndE-ValueType
ZnF_C2H2 57 80 1.64e-1 SMART
ZnF_C2H2 121 143 9.58e-3 SMART
ZnF_C2H2 149 171 1.47e-3 SMART
ZnF_C2H2 208 230 2.91e-2 SMART
low complexity region 333 348 N/A INTRINSIC
ZnF_C2H2 383 405 1.53e-1 SMART
low complexity region 437 455 N/A INTRINSIC
ZnF_C2H2 478 500 1.36e-2 SMART
ZnF_C2H2 506 528 9.58e-3 SMART
ZnF_C2H2 704 727 2.29e0 SMART
low complexity region 854 874 N/A INTRINSIC
low complexity region 947 960 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109155
AA Change: F130S

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104783
Gene: ENSMUSG00000052056
AA Change: F130S

DomainStartEndE-ValueType
ZnF_C2H2 57 80 1.64e-1 SMART
ZnF_C2H2 121 143 9.58e-3 SMART
ZnF_C2H2 149 171 1.47e-3 SMART
ZnF_C2H2 208 230 2.91e-2 SMART
low complexity region 333 348 N/A INTRINSIC
ZnF_C2H2 383 405 1.53e-1 SMART
low complexity region 437 455 N/A INTRINSIC
ZnF_C2H2 478 500 1.36e-2 SMART
ZnF_C2H2 506 528 9.58e-3 SMART
ZnF_C2H2 704 727 2.29e0 SMART
low complexity region 854 874 N/A INTRINSIC
low complexity region 947 960 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125162
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149088
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149318
Meta Mutation Damage Score 0.186 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T A 5: 114,212,636 probably null Het
Agbl3 A G 6: 34,793,965 T132A probably benign Het
Amn1 A T 6: 149,169,452 L196* probably null Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Armc4 T C 18: 7,223,523 probably benign Het
Atp7b C T 8: 22,028,670 D51N probably damaging Het
Brip1 A T 11: 86,152,669 Y356* probably null Het
Ccdc40 C T 11: 119,234,779 P348L probably benign Het
Chrdl2 G A 7: 100,023,868 C9Y probably damaging Het
Chst4 T C 8: 110,030,406 D192G probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
D930048N14Rik T C 11: 51,654,958 *226R probably null Het
Dmgdh T C 13: 93,711,361 V522A probably benign Het
Dtx2 T A 5: 136,012,478 Y246N probably damaging Het
Fam19a1 C A 6: 96,649,138 D112E probably damaging Het
Gtf2ird1 T A 5: 134,388,500 M518L probably benign Het
Hoxc6 T A 15: 103,010,895 W188R probably damaging Het
Igfn1 C T 1: 135,976,917 probably null Het
Kcnip1 A G 11: 33,645,594 V43A probably damaging Het
Kif4-ps A T 12: 101,146,971 E453V probably damaging Het
Kifap3 T A 1: 163,794,026 I81N probably damaging Het
Mgat4d T C 8: 83,358,143 S172P probably damaging Het
Mr1 T C 1: 155,137,591 Y80C probably damaging Het
Nuak2 A G 1: 132,332,080 D532G probably benign Het
Olfr1230 C G 2: 89,296,553 S239T probably benign Het
Olfr1288 A G 2: 111,478,952 H56R probably benign Het
Olfr20 A G 11: 73,354,634 N294D probably damaging Het
Olfr26 A G 9: 38,855,325 K88E possibly damaging Het
Olfr725 T C 14: 50,034,540 T288A possibly damaging Het
Pik3cg A T 12: 32,204,739 F416L probably damaging Het
Prex1 A G 2: 166,617,854 V124A probably damaging Het
Psmb2 T C 4: 126,677,837 M28T probably damaging Het
Ric1 T C 19: 29,567,590 I230T probably damaging Het
Saysd1 T A 14: 20,082,926 K54N probably benign Het
Slc25a17 C T 15: 81,360,700 V11I probably benign Het
Slc5a4a T C 10: 76,176,573 V359A probably benign Het
Slc7a3 T A X: 101,080,875 probably benign Het
Slco1a5 A T 6: 142,268,238 D52E possibly damaging Het
Soat2 T C 15: 102,156,809 probably benign Het
Telo2 C T 17: 25,110,752 R262Q probably damaging Het
Zdhhc14 T A 17: 5,753,091 *490R probably null Het
Zfp712 C T 13: 67,052,392 V10M probably damaging Het
Other mutations in Zfp217
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02021:Zfp217 APN 2 170115149 missense probably benign
IGL02412:Zfp217 APN 2 170112502 utr 3 prime probably benign
IGL02435:Zfp217 APN 2 170119453 missense possibly damaging 0.56
IGL03152:Zfp217 APN 2 170119052 missense probably damaging 1.00
R0107:Zfp217 UTSW 2 170114874 nonsense probably null
R0109:Zfp217 UTSW 2 170115462 missense probably benign 0.31
R0109:Zfp217 UTSW 2 170115462 missense probably benign 0.31
R0110:Zfp217 UTSW 2 170115462 missense probably benign 0.31
R0180:Zfp217 UTSW 2 170120137 missense probably damaging 1.00
R0200:Zfp217 UTSW 2 170115462 missense probably benign 0.31
R0279:Zfp217 UTSW 2 170119780 missense probably benign 0.28
R0395:Zfp217 UTSW 2 170115462 missense probably benign 0.31
R0396:Zfp217 UTSW 2 170115462 missense probably benign 0.31
R0453:Zfp217 UTSW 2 170115462 missense probably benign 0.31
R0510:Zfp217 UTSW 2 170115462 missense probably benign 0.31
R0512:Zfp217 UTSW 2 170115462 missense probably benign 0.31
R0513:Zfp217 UTSW 2 170115462 missense probably benign 0.31
R0653:Zfp217 UTSW 2 170115462 missense probably benign 0.31
R1549:Zfp217 UTSW 2 170114470 missense probably benign 0.00
R3420:Zfp217 UTSW 2 170120017 missense possibly damaging 0.90
R3422:Zfp217 UTSW 2 170120017 missense possibly damaging 0.90
R3726:Zfp217 UTSW 2 170119210 missense probably damaging 0.96
R3731:Zfp217 UTSW 2 170114388 missense probably benign 0.31
R3926:Zfp217 UTSW 2 170112518 missense probably damaging 1.00
R4051:Zfp217 UTSW 2 170112616 critical splice acceptor site probably null
R4289:Zfp217 UTSW 2 170114787 missense probably benign 0.01
R4606:Zfp217 UTSW 2 170119750 missense possibly damaging 0.67
R4948:Zfp217 UTSW 2 170119210 missense probably damaging 0.96
R5113:Zfp217 UTSW 2 170114058 splice site probably null
R5734:Zfp217 UTSW 2 170119144 missense possibly damaging 0.57
R6228:Zfp217 UTSW 2 170119577 missense probably benign 0.01
R6452:Zfp217 UTSW 2 170119294 missense probably benign
R6782:Zfp217 UTSW 2 170116258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTCCATGCCTTGCTGAAG -3'
(R):5'- ACATGCCCCTGGATTGCATG -3'

Sequencing Primer
(F):5'- ATGCCTTGCTGAAGCTTGC -3'
(R):5'- ATGTTCTGCAGCCAGGTC -3'
Posted On2015-02-18