Incidental Mutation 'R3421:Psmb2'
ID267035
Institutional Source Beutler Lab
Gene Symbol Psmb2
Ensembl Gene ENSMUSG00000028837
Gene Nameproteasome (prosome, macropain) subunit, beta type 2
SynonymsHC7-I, D4Wsu33e
MMRRC Submission 040639-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #R3421 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location126677630-126709714 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126677837 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 28 (M28T)
Ref Sequence ENSEMBL: ENSMUSP00000030642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030642]
PDB Structure
Mouse constitutive 20S proteasome in complex with PR-957 [X-RAY DIFFRACTION]
Mouse constitutive 20S proteasome [X-RAY DIFFRACTION]
Mouse 20S immunoproteasome in complex with PR-957 [X-RAY DIFFRACTION]
Mouse 20S immunoproteasome [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000030642
AA Change: M28T

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000030642
Gene: ENSMUSG00000028837
AA Change: M28T

DomainStartEndE-ValueType
Pfam:Proteasome 3 183 2.3e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130737
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150372
Meta Mutation Damage Score 0.348 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T A 5: 114,212,636 probably null Het
Agbl3 A G 6: 34,793,965 T132A probably benign Het
Amn1 A T 6: 149,169,452 L196* probably null Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Armc4 T C 18: 7,223,523 probably benign Het
Atp7b C T 8: 22,028,670 D51N probably damaging Het
Brip1 A T 11: 86,152,669 Y356* probably null Het
Ccdc40 C T 11: 119,234,779 P348L probably benign Het
Chrdl2 G A 7: 100,023,868 C9Y probably damaging Het
Chst4 T C 8: 110,030,406 D192G probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
D930048N14Rik T C 11: 51,654,958 *226R probably null Het
Dmgdh T C 13: 93,711,361 V522A probably benign Het
Dtx2 T A 5: 136,012,478 Y246N probably damaging Het
Fam19a1 C A 6: 96,649,138 D112E probably damaging Het
Gtf2ird1 T A 5: 134,388,500 M518L probably benign Het
Hoxc6 T A 15: 103,010,895 W188R probably damaging Het
Igfn1 C T 1: 135,976,917 probably null Het
Kcnip1 A G 11: 33,645,594 V43A probably damaging Het
Kif4-ps A T 12: 101,146,971 E453V probably damaging Het
Kifap3 T A 1: 163,794,026 I81N probably damaging Het
Mgat4d T C 8: 83,358,143 S172P probably damaging Het
Mr1 T C 1: 155,137,591 Y80C probably damaging Het
Nuak2 A G 1: 132,332,080 D532G probably benign Het
Olfr1230 C G 2: 89,296,553 S239T probably benign Het
Olfr1288 A G 2: 111,478,952 H56R probably benign Het
Olfr20 A G 11: 73,354,634 N294D probably damaging Het
Olfr26 A G 9: 38,855,325 K88E possibly damaging Het
Olfr725 T C 14: 50,034,540 T288A possibly damaging Het
Pik3cg A T 12: 32,204,739 F416L probably damaging Het
Prex1 A G 2: 166,617,854 V124A probably damaging Het
Ric1 T C 19: 29,567,590 I230T probably damaging Het
Saysd1 T A 14: 20,082,926 K54N probably benign Het
Slc25a17 C T 15: 81,360,700 V11I probably benign Het
Slc5a4a T C 10: 76,176,573 V359A probably benign Het
Slc7a3 T A X: 101,080,875 probably benign Het
Slco1a5 A T 6: 142,268,238 D52E possibly damaging Het
Soat2 T C 15: 102,156,809 probably benign Het
Telo2 C T 17: 25,110,752 R262Q probably damaging Het
Zdhhc14 T A 17: 5,753,091 *490R probably null Het
Zfp217 A G 2: 170,120,017 F130S possibly damaging Het
Zfp712 C T 13: 67,052,392 V10M probably damaging Het
Other mutations in Psmb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Psmb2 APN 4 126677849 splice site probably null
IGL00899:Psmb2 APN 4 126707557 missense probably benign 0.08
IGL01089:Psmb2 APN 4 126684206 missense probably damaging 1.00
IGL01373:Psmb2 APN 4 126687092 missense probably damaging 1.00
IGL02694:Psmb2 APN 4 126709558 missense probably benign
R0811:Psmb2 UTSW 4 126707557 missense possibly damaging 0.67
R0812:Psmb2 UTSW 4 126707557 missense possibly damaging 0.67
R1295:Psmb2 UTSW 4 126687032 missense probably damaging 1.00
R1296:Psmb2 UTSW 4 126687032 missense probably damaging 1.00
R1472:Psmb2 UTSW 4 126687032 missense probably damaging 1.00
R3420:Psmb2 UTSW 4 126677837 missense probably damaging 0.96
R3422:Psmb2 UTSW 4 126677837 missense probably damaging 0.96
R4663:Psmb2 UTSW 4 126677765 missense probably damaging 0.99
R5536:Psmb2 UTSW 4 126684209 missense probably damaging 1.00
R5884:Psmb2 UTSW 4 126684221 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CAATCTCAGCGCGGAAAAG -3'
(R):5'- TAGCAAGCCTCATCTGACCC -3'

Sequencing Primer
(F):5'- CGCGAGAGGTGACGTCATTG -3'
(R):5'- CTAAGCTTGTCTGCCGGC -3'
Posted On2015-02-18