Mutagenetix > Incidental Mutations

Incidental Mutation 'R3421:Gtf2ird1'

267037

Institutional Source

Beutler Lab

Gene Symbol

Gtf2ird1

Ensembl Gene

ENSMUSG00000023079

Gene Name

general transcription factor II I repeat domain-containing 1

Synonyms

binding factor for early enhancer, MusTRD1, GTF3, WBSCR11, Tg(Alb1-Myc)166.8Sst, ESTM9, c-myc line 166.8, Alb/c-myc line 166.8, Alb-c-myc line 166.8, Cream1, BEN

MMRRC Submission

040639-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.559) question?

Stock #

R3421 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

134357656-134456716 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 134388500 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 518 (M518L)

Ref Sequence

ENSEMBL: ENSMUSP00000143897 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073161] [ENSMUST00000074114] [ENSMUST00000100650] [ENSMUST00000100652] [ENSMUST00000100654] [ENSMUST00000111244] [ENSMUST00000111245] [ENSMUST00000167084] [ENSMUST00000171794] [ENSMUST00000200944] [ENSMUST00000202165] [ENSMUST00000202280] [ENSMUST00000202321] [ENSMUST00000202554]

Predicted Effect

probably benign
Transcript: ENSMUST00000073161
AA Change: M518L

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000072904
Gene: ENSMUSG00000023079
AA Change: M518L

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	203	1.5e-29	PFAM
Pfam:GTF2I	351	426	4.9e-33	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	640	1.1e-34	PFAM
Pfam:GTF2I	690	765	3.1e-34	PFAM
Pfam:GTF2I	814	889	1.7e-34	PFAM
Pfam:GTF2I	917	992	1.7e-34	PFAM
low complexity region	1020	1043	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000074114
AA Change: M518L

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000073752
Gene: ENSMUSG00000023079
AA Change: M518L

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	203	1.4e-29	PFAM
Pfam:GTF2I	351	426	4.5e-33	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	640	1.1e-34	PFAM
Pfam:GTF2I	690	765	2.8e-34	PFAM
Pfam:GTF2I	814	889	1.6e-34	PFAM
low complexity region	917	940	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000100650
AA Change: M518L

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000098215
Gene: ENSMUSG00000023079
AA Change: M518L

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	203	1.5e-29	PFAM
Pfam:GTF2I	351	426	4.9e-33	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	640	1.2e-34	PFAM
Pfam:GTF2I	690	765	3.1e-34	PFAM
Pfam:GTF2I	787	862	1.8e-34	PFAM
Pfam:GTF2I	890	965	1.8e-34	PFAM
low complexity region	993	1016	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000100652
AA Change: M518L

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000098217
Gene: ENSMUSG00000023079
AA Change: M518L

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	202	5.8e-29	PFAM
Pfam:GTF2I	351	425	6.6e-32	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	639	2.3e-34	PFAM
Pfam:GTF2I	690	764	3.3e-32	PFAM
Pfam:GTF2I	814	888	3e-33	PFAM
Pfam:GTF2I	917	991	3e-33	PFAM
low complexity region	1020	1043	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000100654
AA Change: M518L

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000098219
Gene: ENSMUSG00000023079
AA Change: M518L

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	203	1.3e-29	PFAM
Pfam:GTF2I	351	426	4.3e-33	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	640	1e-34	PFAM
Pfam:GTF2I	716	791	1.5e-34	PFAM
Pfam:GTF2I	819	894	1.5e-34	PFAM
low complexity region	922	945	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000111244
AA Change: M518L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000106875
Gene: ENSMUSG00000023079
AA Change: M518L

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	202	4.3e-29	PFAM
Pfam:GTF2I	351	425	4.9e-32	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	639	1.7e-34	PFAM
Pfam:GTF2I	690	764	2.5e-32	PFAM
Pfam:GTF2I	787	861	2.3e-33	PFAM
Pfam:GTF2I	890	964	2.3e-33	PFAM
low complexity region	993	1016	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000111245
AA Change: M518L

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000106876
Gene: ENSMUSG00000023079
AA Change: M518L

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	203	1.4e-29	PFAM
Pfam:GTF2I	351	426	4.6e-33	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	640	1.1e-34	PFAM
Pfam:GTF2I	671	746	2.9e-34	PFAM
Pfam:GTF2I	768	843	1.7e-34	PFAM
Pfam:GTF2I	871	946	1.7e-34	PFAM
low complexity region	974	997	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000167084
AA Change: M518L

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000132882
Gene: ENSMUSG00000023079
AA Change: M518L

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	203	1.3e-29	PFAM
Pfam:GTF2I	351	426	4.3e-33	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	640	1e-34	PFAM
Pfam:GTF2I	690	765	2.7e-34	PFAM
Pfam:GTF2I	814	889	1.5e-34	PFAM
low complexity region	917	940	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000171794
AA Change: M518L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000129392
Gene: ENSMUSG00000023079
AA Change: M518L

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	203	1.2e-29	PFAM
Pfam:GTF2I	351	426	3.8e-33	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	640	8.9e-35	PFAM
Pfam:GTF2I	690	765	2.4e-34	PFAM
Pfam:GTF2I	787	862	1.4e-34	PFAM
Pfam:GTF2I	890	965	1.4e-34	PFAM
low complexity region	993	1016	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000200798

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200817

Predicted Effect

probably benign
Transcript: ENSMUST00000200944
AA Change: M518L

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000143848
Gene: ENSMUSG00000023079
AA Change: M518L

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	202	4.9e-29	PFAM
Pfam:GTF2I	351	425	5.6e-32	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	639	2e-34	PFAM
Pfam:GTF2I	690	764	2.8e-32	PFAM
Pfam:GTF2I	814	888	2.6e-33	PFAM
low complexity region	917	940	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000201441

Predicted Effect

probably benign
Transcript: ENSMUST00000201447

Predicted Effect

probably benign
Transcript: ENSMUST00000201495

Predicted Effect

probably benign
Transcript: ENSMUST00000201526

Predicted Effect

probably benign
Transcript: ENSMUST00000201704

Predicted Effect

probably benign
Transcript: ENSMUST00000202165

SMART Domains

Protein: ENSMUSP00000144420
Gene: ENSMUSG00000023079

Domain	Start	End	E-Value	Type
low complexity region	13	28	N/A	INTRINSIC
Pfam:GTF2I	35	109	7.6e-33	PFAM
Pfam:GTF2I	167	193	4.2e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202202

Predicted Effect

probably benign
Transcript: ENSMUST00000202280
AA Change: M518L

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000143897
Gene: ENSMUSG00000023079
AA Change: M518L

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	202	2.6e-26	PFAM
Pfam:GTF2I	351	425	2.9e-29	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	639	1e-31	PFAM
Pfam:GTF2I	690	764	1.5e-29	PFAM
Pfam:GTF2I	787	861	1.3e-30	PFAM
low complexity region	890	913	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000202321

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202334

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202335

Predicted Effect

probably benign
Transcript: ENSMUST00000202554
AA Change: M518L

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000143809
Gene: ENSMUSG00000023079
AA Change: M518L

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	202	5.5e-29	PFAM
Pfam:GTF2I	351	425	6.3e-32	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	639	2.2e-34	PFAM
Pfam:GTF2I	671	745	3.2e-32	PFAM
Pfam:GTF2I	768	842	2.9e-33	PFAM
Pfam:GTF2I	871	945	2.9e-33	PFAM
low complexity region	974	997	N/A	INTRINSIC

Meta Mutation Damage Score

0.098

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.0%

Validation Efficiency

100% (46/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains five GTF2I-like repeats and each repeat possesses a potential helix-loop-helix (HLH) motif. It may have the ability to interact with other HLH-proteins and function as a transcription factor or as a positive transcriptional regulator under the control of Retinoblastoma protein. This gene plays a role in craniofacial and cognitive development and mutations have been associated with Williams-Beuren syndrome, a multisystem developmental disorder caused by deletion of multiple genes at 7q11.23. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygotes for one null allele is embryonic lethal with abnormal yolk sac vasulogenesis, abnormal angiogenesis, and neural tube defect. Other null allele homozygous mice are viable and have behavioral defects and exhibit a mild craniofacial defect withvariable penetrance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acacb	T	A	5: 114,212,636		probably null	Het
Agbl3	A	G	6: 34,793,965	T132A	probably benign	Het
Amn1	A	T	6: 149,169,452	L196*	probably null	Het
Ap3b2	C	T	7: 81,473,850		probably benign	Het
Armc4	T	C	18: 7,223,523		probably benign	Het
Atp7b	C	T	8: 22,028,670	D51N	probably damaging	Het
Brip1	A	T	11: 86,152,669	Y356*	probably null	Het
Ccdc40	C	T	11: 119,234,779	P348L	probably benign	Het
Chrdl2	G	A	7: 100,023,868	C9Y	probably damaging	Het
Chst4	T	C	8: 110,030,406	D192G	probably damaging	Het
Col9a2	C	G	4: 121,054,258	R599G	probably damaging	Het
D930048N14Rik	T	C	11: 51,654,958	*226R	probably null	Het
Dmgdh	T	C	13: 93,711,361	V522A	probably benign	Het
Dtx2	T	A	5: 136,012,478	Y246N	probably damaging	Het
Fam19a1	C	A	6: 96,649,138	D112E	probably damaging	Het
Hoxc6	T	A	15: 103,010,895	W188R	probably damaging	Het
Igfn1	C	T	1: 135,976,917		probably null	Het
Kcnip1	A	G	11: 33,645,594	V43A	probably damaging	Het
Kif4-ps	A	T	12: 101,146,971	E453V	probably damaging	Het
Kifap3	T	A	1: 163,794,026	I81N	probably damaging	Het
Mgat4d	T	C	8: 83,358,143	S172P	probably damaging	Het
Mr1	T	C	1: 155,137,591	Y80C	probably damaging	Het
Nuak2	A	G	1: 132,332,080	D532G	probably benign	Het
Olfr1230	C	G	2: 89,296,553	S239T	probably benign	Het
Olfr1288	A	G	2: 111,478,952	H56R	probably benign	Het
Olfr20	A	G	11: 73,354,634	N294D	probably damaging	Het
Olfr26	A	G	9: 38,855,325	K88E	possibly damaging	Het
Olfr725	T	C	14: 50,034,540	T288A	possibly damaging	Het
Pik3cg	A	T	12: 32,204,739	F416L	probably damaging	Het
Prex1	A	G	2: 166,617,854	V124A	probably damaging	Het
Psmb2	T	C	4: 126,677,837	M28T	probably damaging	Het
Ric1	T	C	19: 29,567,590	I230T	probably damaging	Het
Saysd1	T	A	14: 20,082,926	K54N	probably benign	Het
Slc25a17	C	T	15: 81,360,700	V11I	probably benign	Het
Slc5a4a	T	C	10: 76,176,573	V359A	probably benign	Het
Slc7a3	T	A	X: 101,080,875		probably benign	Het
Slco1a5	A	T	6: 142,268,238	D52E	possibly damaging	Het
Soat2	T	C	15: 102,156,809		probably benign	Het
Telo2	C	T	17: 25,110,752	R262Q	probably damaging	Het
Zdhhc14	T	A	17: 5,753,091	*490R	probably null	Het
Zfp217	A	G	2: 170,120,017	F130S	possibly damaging	Het
Zfp712	C	T	13: 67,052,392	V10M	probably damaging	Het

Other mutations in Gtf2ird1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00558:Gtf2ird1	APN	5	134358891	missense	probably benign	0.03
IGL02477:Gtf2ird1	APN	5	134379978	missense	probably damaging	1.00
IGL02659:Gtf2ird1	APN	5	134377041	missense	probably damaging	1.00
IGL02752:Gtf2ird1	APN	5	134358824	makesense	probably null
IGL02963:Gtf2ird1	APN	5	134389687	missense	probably benign	0.05
IGL03328:Gtf2ird1	APN	5	134389129	critical splice donor site	probably null
IGL03379:Gtf2ird1	APN	5	134382538	missense	possibly damaging	0.94
R0585:Gtf2ird1	UTSW	5	134376942	missense	probably damaging	1.00
R1199:Gtf2ird1	UTSW	5	134411064	missense	possibly damaging	0.85
R1388:Gtf2ird1	UTSW	5	134395710	missense	probably damaging	1.00
R1470:Gtf2ird1	UTSW	5	134395802	critical splice acceptor site	probably null
R1470:Gtf2ird1	UTSW	5	134395802	critical splice acceptor site	probably null
R1544:Gtf2ird1	UTSW	5	134358918	missense	possibly damaging	0.93
R1652:Gtf2ird1	UTSW	5	134395713	missense	probably damaging	1.00
R1792:Gtf2ird1	UTSW	5	134366936	intron	probably null
R1852:Gtf2ird1	UTSW	5	134382580	unclassified	probably null
R1938:Gtf2ird1	UTSW	5	134415245	missense	probably damaging	1.00
R1996:Gtf2ird1	UTSW	5	134376886	splice site	probably benign
R2020:Gtf2ird1	UTSW	5	134417093	missense	probably damaging	1.00
R2025:Gtf2ird1	UTSW	5	134363934	missense	probably damaging	1.00
R2849:Gtf2ird1	UTSW	5	134359007	missense	probably damaging	1.00
R2964:Gtf2ird1	UTSW	5	134357684	unclassified	probably null
R4543:Gtf2ird1	UTSW	5	134363900	critical splice donor site	probably null
R4569:Gtf2ird1	UTSW	5	134411003	missense	probably damaging	1.00
R4664:Gtf2ird1	UTSW	5	134383902	missense	probably damaging	1.00
R4665:Gtf2ird1	UTSW	5	134383902	missense	probably damaging	1.00
R4666:Gtf2ird1	UTSW	5	134383902	missense	probably damaging	1.00
R4680:Gtf2ird1	UTSW	5	134357881	missense	probably damaging	1.00
R4709:Gtf2ird1	UTSW	5	134404734	missense	probably benign
R4806:Gtf2ird1	UTSW	5	134383896	missense	probably damaging	0.99
R4823:Gtf2ird1	UTSW	5	134395722	missense	probably damaging	1.00
R4857:Gtf2ird1	UTSW	5	134362544	missense	probably damaging	0.96
R4970:Gtf2ird1	UTSW	5	134402184	missense	probably damaging	1.00
R4974:Gtf2ird1	UTSW	5	134357831	nonsense	probably null
R4975:Gtf2ird1	UTSW	5	134395627	missense	probably damaging	1.00
R5072:Gtf2ird1	UTSW	5	134390933	splice site	probably null
R5112:Gtf2ird1	UTSW	5	134402184	missense	probably damaging	1.00
R5653:Gtf2ird1	UTSW	5	134410967	missense	probably damaging	1.00
R5681:Gtf2ird1	UTSW	5	134363318	missense	probably damaging	1.00
R5738:Gtf2ird1	UTSW	5	134383818	missense	probably damaging	1.00
R5753:Gtf2ird1	UTSW	5	134410983	missense	probably damaging	1.00
R6385:Gtf2ird1	UTSW	5	134404690	missense	probably benign	0.19
R6580:Gtf2ird1	UTSW	5	134361039	missense	probably damaging	1.00
R6787:Gtf2ird1	UTSW	5	134363912	missense	probably damaging	0.99
X0026:Gtf2ird1	UTSW	5	134376102	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- AGTCTTCTCCAACAAAGGCAAG -3'
(R):5'- CAGTGCTCATACCATCAGGC -3'

Sequencing Primer
(F):5'- AGGACTTCCTGACCCACCTG -3'
(R):5'- GATAGGATCTGATTCCTGAACCCG -3'

Posted On

2015-02-18