Incidental Mutation 'R3421:Dtx2'
ID267038
Institutional Source Beutler Lab
Gene Symbol Dtx2
Ensembl Gene ENSMUSG00000004947
Gene Namedeltex 2, E3 ubiquitin ligase
Synonyms
MMRRC Submission 040639-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3421 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location135994800-136032872 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 136012478 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 246 (Y246N)
Ref Sequence ENSEMBL: ENSMUSP00000115122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005072] [ENSMUST00000111142] [ENSMUST00000111144] [ENSMUST00000111145] [ENSMUST00000125827] [ENSMUST00000130345] [ENSMUST00000199239]
Predicted Effect probably damaging
Transcript: ENSMUST00000005072
AA Change: Y246N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005072
Gene: ENSMUSG00000004947
AA Change: Y246N

DomainStartEndE-ValueType
WWE 17 105 2.02e-31 SMART
WWE 107 182 6.98e-26 SMART
low complexity region 281 318 N/A INTRINSIC
RING 408 468 2.49e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111142
AA Change: Y246N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106772
Gene: ENSMUSG00000004947
AA Change: Y246N

DomainStartEndE-ValueType
WWE 17 105 2.02e-31 SMART
WWE 107 182 6.98e-26 SMART
low complexity region 281 318 N/A INTRINSIC
RING 409 469 2.49e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111144
AA Change: Y246N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106774
Gene: ENSMUSG00000004947
AA Change: Y246N

DomainStartEndE-ValueType
WWE 17 105 2.02e-31 SMART
WWE 107 182 6.98e-26 SMART
low complexity region 281 318 N/A INTRINSIC
RING 363 423 2.49e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111145
AA Change: Y246N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106775
Gene: ENSMUSG00000004947
AA Change: Y246N

DomainStartEndE-ValueType
WWE 17 105 2.02e-31 SMART
WWE 107 182 6.98e-26 SMART
low complexity region 281 318 N/A INTRINSIC
RING 363 423 2.49e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125827
AA Change: Y246N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115122
Gene: ENSMUSG00000004947
AA Change: Y246N

DomainStartEndE-ValueType
WWE 17 105 2.02e-31 SMART
WWE 107 182 6.98e-26 SMART
low complexity region 281 318 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130345
Predicted Effect probably benign
Transcript: ENSMUST00000199239
SMART Domains Protein: ENSMUSP00000142472
Gene: ENSMUSG00000004947

DomainStartEndE-ValueType
WWE 17 105 8.4e-34 SMART
WWE 107 151 3.9e-4 SMART
Meta Mutation Damage Score 0.118 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DTX2 functions as an E3 ubiquitin ligase (Takeyama et al., 2003 [PubMed 12670957]).[supplied by OMIM, Nov 2009]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal with no detectable abnormalities in T or B cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T A 5: 114,212,636 probably null Het
Agbl3 A G 6: 34,793,965 T132A probably benign Het
Amn1 A T 6: 149,169,452 L196* probably null Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Armc4 T C 18: 7,223,523 probably benign Het
Atp7b C T 8: 22,028,670 D51N probably damaging Het
Brip1 A T 11: 86,152,669 Y356* probably null Het
Ccdc40 C T 11: 119,234,779 P348L probably benign Het
Chrdl2 G A 7: 100,023,868 C9Y probably damaging Het
Chst4 T C 8: 110,030,406 D192G probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
D930048N14Rik T C 11: 51,654,958 *226R probably null Het
Dmgdh T C 13: 93,711,361 V522A probably benign Het
Fam19a1 C A 6: 96,649,138 D112E probably damaging Het
Gtf2ird1 T A 5: 134,388,500 M518L probably benign Het
Hoxc6 T A 15: 103,010,895 W188R probably damaging Het
Igfn1 C T 1: 135,976,917 probably null Het
Kcnip1 A G 11: 33,645,594 V43A probably damaging Het
Kif4-ps A T 12: 101,146,971 E453V probably damaging Het
Kifap3 T A 1: 163,794,026 I81N probably damaging Het
Mgat4d T C 8: 83,358,143 S172P probably damaging Het
Mr1 T C 1: 155,137,591 Y80C probably damaging Het
Nuak2 A G 1: 132,332,080 D532G probably benign Het
Olfr1230 C G 2: 89,296,553 S239T probably benign Het
Olfr1288 A G 2: 111,478,952 H56R probably benign Het
Olfr20 A G 11: 73,354,634 N294D probably damaging Het
Olfr26 A G 9: 38,855,325 K88E possibly damaging Het
Olfr725 T C 14: 50,034,540 T288A possibly damaging Het
Pik3cg A T 12: 32,204,739 F416L probably damaging Het
Prex1 A G 2: 166,617,854 V124A probably damaging Het
Psmb2 T C 4: 126,677,837 M28T probably damaging Het
Ric1 T C 19: 29,567,590 I230T probably damaging Het
Saysd1 T A 14: 20,082,926 K54N probably benign Het
Slc25a17 C T 15: 81,360,700 V11I probably benign Het
Slc5a4a T C 10: 76,176,573 V359A probably benign Het
Slc7a3 T A X: 101,080,875 probably benign Het
Slco1a5 A T 6: 142,268,238 D52E possibly damaging Het
Soat2 T C 15: 102,156,809 probably benign Het
Telo2 C T 17: 25,110,752 R262Q probably damaging Het
Zdhhc14 T A 17: 5,753,091 *490R probably null Het
Zfp217 A G 2: 170,120,017 F130S possibly damaging Het
Zfp712 C T 13: 67,052,392 V10M probably damaging Het
Other mutations in Dtx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01077:Dtx2 APN 5 136029203 missense possibly damaging 0.95
IGL01536:Dtx2 APN 5 136010086 utr 5 prime probably benign
IGL01584:Dtx2 APN 5 136026566 missense possibly damaging 0.49
IGL01782:Dtx2 APN 5 136010127 nonsense probably null
IGL03091:Dtx2 APN 5 136012374 missense probably damaging 1.00
R0499:Dtx2 UTSW 5 136029103 missense probably damaging 1.00
R0580:Dtx2 UTSW 5 136032326 missense probably damaging 1.00
R1988:Dtx2 UTSW 5 136032293 nonsense probably null
R2062:Dtx2 UTSW 5 136030577 missense probably damaging 1.00
R2063:Dtx2 UTSW 5 136030577 missense probably damaging 1.00
R2064:Dtx2 UTSW 5 136030577 missense probably damaging 1.00
R2065:Dtx2 UTSW 5 136030577 missense probably damaging 1.00
R2068:Dtx2 UTSW 5 136030577 missense probably damaging 1.00
R2108:Dtx2 UTSW 5 136030577 missense probably damaging 1.00
R2110:Dtx2 UTSW 5 136030577 missense probably damaging 1.00
R2111:Dtx2 UTSW 5 136030577 missense probably damaging 1.00
R2130:Dtx2 UTSW 5 136012040 missense probably damaging 0.96
R2146:Dtx2 UTSW 5 136030610 missense probably benign 0.21
R3108:Dtx2 UTSW 5 136021816 missense probably benign 0.01
R4467:Dtx2 UTSW 5 136012076 missense probably damaging 1.00
R4741:Dtx2 UTSW 5 136026517 missense probably benign 0.00
R5083:Dtx2 UTSW 5 136012190 missense probably damaging 1.00
R5318:Dtx2 UTSW 5 136012100 missense possibly damaging 0.92
R5705:Dtx2 UTSW 5 136010295 missense probably damaging 1.00
R5964:Dtx2 UTSW 5 136023699 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTCAGACATCGCTGTTCCACG -3'
(R):5'- GCTTTCCACACGGGTAGAAG -3'

Sequencing Primer
(F):5'- CGCCAAATGGGACTTATCTGC -3'
(R):5'- CTTTCCACACGGGTAGAAGTAAAGTC -3'
Posted On2015-02-18