Incidental Mutation 'R3421:Brip1'
ID267054
Institutional Source Beutler Lab
Gene Symbol Brip1
Ensembl Gene ENSMUSG00000034329
Gene NameBRCA1 interacting protein C-terminal helicase 1
Synonyms8030460J03Rik, 3110009N10Rik, BACH1
MMRRC Submission 040639-MU
Accession Numbers

Ncbi RefSeq: NM_178309.2; MGI:2442836

Is this an essential gene? Probably essential (E-score: 0.757) question?
Stock #R3421 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location86058138-86201193 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 86152669 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 356 (Y356*)
Ref Sequence ENSEMBL: ENSMUSP00000043108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044423]
Predicted Effect probably null
Transcript: ENSMUST00000044423
AA Change: Y356*
SMART Domains Protein: ENSMUSP00000043108
Gene: ENSMUSG00000034329
AA Change: Y356*

DomainStartEndE-ValueType
DEXDc 17 520 1.4e-3 SMART
HELICc 701 854 8.2e-41 SMART
Meta Mutation Damage Score 0.6428 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: This gene encodes a member of the DEAH subfamily of DEAD box helicases. A similar protein in humans is both a DNA-dependent ATPase and a 5-prime-to-3-prime DNA helicase, and plays a role in the repair of DNA double stranded breaks through interaction with the breast cancer-associated tumor suppressor BRCA1. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit gonadal atrophy, subfertility, germ cell attrition, epithelial tumor predisposition, increased cellular sensitivity to interstrand crosslink-inducing agents, hypersensitivity to replication inhibitors, and predisposition to lymphoma. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T A 5: 114,212,636 probably null Het
Agbl3 A G 6: 34,793,965 T132A probably benign Het
Amn1 A T 6: 149,169,452 L196* probably null Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Armc4 T C 18: 7,223,523 probably benign Het
Atp7b C T 8: 22,028,670 D51N probably damaging Het
Ccdc40 C T 11: 119,234,779 P348L probably benign Het
Chrdl2 G A 7: 100,023,868 C9Y probably damaging Het
Chst4 T C 8: 110,030,406 D192G probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
D930048N14Rik T C 11: 51,654,958 *226R probably null Het
Dmgdh T C 13: 93,711,361 V522A probably benign Het
Dtx2 T A 5: 136,012,478 Y246N probably damaging Het
Fam19a1 C A 6: 96,649,138 D112E probably damaging Het
Gtf2ird1 T A 5: 134,388,500 M518L probably benign Het
Hoxc6 T A 15: 103,010,895 W188R probably damaging Het
Igfn1 C T 1: 135,976,917 probably null Het
Kcnip1 A G 11: 33,645,594 V43A probably damaging Het
Kif4-ps A T 12: 101,146,971 E453V probably damaging Het
Kifap3 T A 1: 163,794,026 I81N probably damaging Het
Mgat4d T C 8: 83,358,143 S172P probably damaging Het
Mr1 T C 1: 155,137,591 Y80C probably damaging Het
Nuak2 A G 1: 132,332,080 D532G probably benign Het
Olfr1230 C G 2: 89,296,553 S239T probably benign Het
Olfr1288 A G 2: 111,478,952 H56R probably benign Het
Olfr20 A G 11: 73,354,634 N294D probably damaging Het
Olfr26 A G 9: 38,855,325 K88E possibly damaging Het
Olfr725 T C 14: 50,034,540 T288A possibly damaging Het
Pik3cg A T 12: 32,204,739 F416L probably damaging Het
Prex1 A G 2: 166,617,854 V124A probably damaging Het
Psmb2 T C 4: 126,677,837 M28T probably damaging Het
Ric1 T C 19: 29,567,590 I230T probably damaging Het
Saysd1 T A 14: 20,082,926 K54N probably benign Het
Slc25a17 C T 15: 81,360,700 V11I probably benign Het
Slc5a4a T C 10: 76,176,573 V359A probably benign Het
Slc7a3 T A X: 101,080,875 probably benign Het
Slco1a5 A T 6: 142,268,238 D52E possibly damaging Het
Soat2 T C 15: 102,156,809 probably benign Het
Telo2 C T 17: 25,110,752 R262Q probably damaging Het
Zdhhc14 T A 17: 5,753,091 *490R probably null Het
Zfp217 A G 2: 170,120,017 F130S possibly damaging Het
Zfp712 C T 13: 67,052,392 V10M probably damaging Het
Other mutations in Brip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Brip1 APN 11 86148401 missense possibly damaging 0.53
IGL01098:Brip1 APN 11 86108862 missense possibly damaging 0.71
IGL01503:Brip1 APN 11 86061877 missense probably benign 0.33
IGL01602:Brip1 APN 11 86062004 missense possibly damaging 0.53
IGL01605:Brip1 APN 11 86062004 missense possibly damaging 0.53
IGL01940:Brip1 APN 11 86064966 missense probably benign 0.00
IGL02019:Brip1 APN 11 86197949 missense possibly damaging 0.73
IGL02212:Brip1 APN 11 86139015 missense possibly damaging 0.86
IGL02456:Brip1 APN 11 86065099 missense possibly damaging 0.71
IGL02727:Brip1 APN 11 86152736 missense probably benign 0.02
IGL02983:Brip1 APN 11 86139124 missense probably benign 0.03
IGL03022:Brip1 APN 11 86077950 missense probably damaging 0.98
IGL03116:Brip1 APN 11 86064909 nonsense probably null
IGL03143:Brip1 APN 11 86061827 missense possibly damaging 0.53
P0018:Brip1 UTSW 11 86108868 missense possibly damaging 0.51
R0011:Brip1 UTSW 11 86186998 missense possibly damaging 0.72
R0011:Brip1 UTSW 11 86186998 missense possibly damaging 0.72
R0446:Brip1 UTSW 11 86157601 missense probably damaging 0.98
R0498:Brip1 UTSW 11 86197919 missense possibly damaging 0.96
R0599:Brip1 UTSW 11 86152737 missense probably benign
R0653:Brip1 UTSW 11 86152658 missense possibly damaging 0.85
R0661:Brip1 UTSW 11 86110363 missense possibly damaging 0.86
R0671:Brip1 UTSW 11 86152667 missense possibly damaging 0.93
R0718:Brip1 UTSW 11 86143305 missense possibly damaging 0.96
R0750:Brip1 UTSW 11 86061499 missense possibly damaging 0.53
R0834:Brip1 UTSW 11 86192827 missense probably benign
R1128:Brip1 UTSW 11 86064937 missense possibly damaging 0.86
R1726:Brip1 UTSW 11 86064914 missense probably benign 0.17
R1813:Brip1 UTSW 11 86187080 missense possibly damaging 0.53
R1885:Brip1 UTSW 11 86138815 missense probably damaging 1.00
R1886:Brip1 UTSW 11 86138815 missense probably damaging 1.00
R2093:Brip1 UTSW 11 86139145 missense possibly damaging 0.53
R2206:Brip1 UTSW 11 86061877 missense probably benign 0.33
R2207:Brip1 UTSW 11 86061877 missense probably benign 0.33
R3404:Brip1 UTSW 11 86143263 missense possibly damaging 0.96
R3876:Brip1 UTSW 11 86152790 missense probably damaging 0.98
R4018:Brip1 UTSW 11 86138851 missense possibly damaging 0.86
R4092:Brip1 UTSW 11 86148521 missense possibly damaging 0.92
R4384:Brip1 UTSW 11 86148429 missense possibly damaging 0.70
R4394:Brip1 UTSW 11 86074298 missense possibly damaging 0.85
R4518:Brip1 UTSW 11 86077878 missense possibly damaging 0.92
R4522:Brip1 UTSW 11 86189801 missense possibly damaging 0.49
R4840:Brip1 UTSW 11 86146183 missense possibly damaging 0.86
R5025:Brip1 UTSW 11 86064980 missense probably benign 0.04
R5176:Brip1 UTSW 11 86077884 missense probably damaging 0.98
R5213:Brip1 UTSW 11 86143321 missense possibly damaging 0.73
R5470:Brip1 UTSW 11 86148542 missense possibly damaging 0.71
R5525:Brip1 UTSW 11 86110447 missense possibly damaging 0.85
R6057:Brip1 UTSW 11 86065039 missense possibly damaging 0.73
R6819:Brip1 UTSW 11 86110441 missense possibly damaging 0.51
R6908:Brip1 UTSW 11 86077884 missense probably damaging 0.98
R6920:Brip1 UTSW 11 86148536 nonsense probably null
X0060:Brip1 UTSW 11 86152619 missense possibly damaging 0.71
X0062:Brip1 UTSW 11 86143356 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- AGTGGAGAGAACCATGGTTATC -3'
(R):5'- TTGGTTCACATATCACTTATGTCTG -3'

Sequencing Primer
(F):5'- ACAATTTTGCTCCACAGGGG -3'
(R):5'- CATATCACTTATGTCTGTTTTCAGGG -3'
Posted On2015-02-18