Incidental Mutation 'R3421:Pik3cg'
ID267056
Institutional Source Beutler Lab
Gene Symbol Pik3cg
Ensembl Gene ENSMUSG00000020573
Gene Namephosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma
SynonymsPI(3)Kgamma, p110gamma, 5830428L06Rik, PI3K, PI3Kgamma
MMRRC Submission 040639-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3421 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location32173473-32208659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32204739 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 416 (F416L)
Ref Sequence ENSEMBL: ENSMUSP00000151400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053215] [ENSMUST00000085469] [ENSMUST00000156904] [ENSMUST00000217915] [ENSMUST00000220366]
Predicted Effect probably damaging
Transcript: ENSMUST00000053215
AA Change: F416L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062864
Gene: ENSMUSG00000020573
AA Change: F416L

DomainStartEndE-ValueType
PI3K_rbd 203 312 3.56e-43 SMART
PI3K_C2 349 452 1.15e-28 SMART
PI3Ka 541 733 4.41e-89 SMART
PI3Kc 829 1094 3.9e-131 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000085469
AA Change: F416L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000082596
Gene: ENSMUSG00000020573
AA Change: F416L

DomainStartEndE-ValueType
PI3K_rbd 203 312 3.56e-43 SMART
PI3K_C2 349 452 1.15e-28 SMART
PI3Ka 541 733 4.41e-89 SMART
PI3Kc 829 1094 3.9e-131 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126814
Predicted Effect probably damaging
Transcript: ENSMUST00000156904
AA Change: F416L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123539
Gene: ENSMUSG00000020573
AA Change: F416L

DomainStartEndE-ValueType
PI3K_rbd 203 312 3.56e-43 SMART
PI3K_C2 349 452 1.15e-28 SMART
PI3Ka 541 733 4.41e-89 SMART
PI3Kc 829 1094 3.9e-131 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000217915
AA Change: F416L

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000220366
AA Change: F416L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.0256 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphoinositide 3-kinases (PI3Ks) phosphorylate inositol lipids and are involved in the immune response. The protein encoded by this gene is a class I catalytic subunit of PI3K. Like other class I catalytic subunits (p110-alpha p110-beta, and p110-delta), the encoded protein binds a p85 regulatory subunit to form PI3K. This gene is located in a commonly deleted segment of chromosome 7 previously identified in myeloid leukemias. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jun 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display defects in thymocyte development, T cell activation, and neutrophil migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T A 5: 114,212,636 probably null Het
Agbl3 A G 6: 34,793,965 T132A probably benign Het
Amn1 A T 6: 149,169,452 L196* probably null Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Armc4 T C 18: 7,223,523 probably benign Het
Atp7b C T 8: 22,028,670 D51N probably damaging Het
Brip1 A T 11: 86,152,669 Y356* probably null Het
Ccdc40 C T 11: 119,234,779 P348L probably benign Het
Chrdl2 G A 7: 100,023,868 C9Y probably damaging Het
Chst4 T C 8: 110,030,406 D192G probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
D930048N14Rik T C 11: 51,654,958 *226R probably null Het
Dmgdh T C 13: 93,711,361 V522A probably benign Het
Dtx2 T A 5: 136,012,478 Y246N probably damaging Het
Fam19a1 C A 6: 96,649,138 D112E probably damaging Het
Gtf2ird1 T A 5: 134,388,500 M518L probably benign Het
Hoxc6 T A 15: 103,010,895 W188R probably damaging Het
Igfn1 C T 1: 135,976,917 probably null Het
Kcnip1 A G 11: 33,645,594 V43A probably damaging Het
Kif4-ps A T 12: 101,146,971 E453V probably damaging Het
Kifap3 T A 1: 163,794,026 I81N probably damaging Het
Mgat4d T C 8: 83,358,143 S172P probably damaging Het
Mr1 T C 1: 155,137,591 Y80C probably damaging Het
Nuak2 A G 1: 132,332,080 D532G probably benign Het
Olfr1230 C G 2: 89,296,553 S239T probably benign Het
Olfr1288 A G 2: 111,478,952 H56R probably benign Het
Olfr20 A G 11: 73,354,634 N294D probably damaging Het
Olfr26 A G 9: 38,855,325 K88E possibly damaging Het
Olfr725 T C 14: 50,034,540 T288A possibly damaging Het
Prex1 A G 2: 166,617,854 V124A probably damaging Het
Psmb2 T C 4: 126,677,837 M28T probably damaging Het
Ric1 T C 19: 29,567,590 I230T probably damaging Het
Saysd1 T A 14: 20,082,926 K54N probably benign Het
Slc25a17 C T 15: 81,360,700 V11I probably benign Het
Slc5a4a T C 10: 76,176,573 V359A probably benign Het
Slc7a3 T A X: 101,080,875 probably benign Het
Slco1a5 A T 6: 142,268,238 D52E possibly damaging Het
Soat2 T C 15: 102,156,809 probably benign Het
Telo2 C T 17: 25,110,752 R262Q probably damaging Het
Zdhhc14 T A 17: 5,753,091 *490R probably null Het
Zfp217 A G 2: 170,120,017 F130S possibly damaging Het
Zfp712 C T 13: 67,052,392 V10M probably damaging Het
Other mutations in Pik3cg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Pik3cg APN 12 32205149 missense probably damaging 1.00
IGL02182:Pik3cg APN 12 32205273 missense possibly damaging 0.90
IGL02273:Pik3cg APN 12 32176810 missense probably damaging 1.00
IGL02312:Pik3cg APN 12 32194821 missense possibly damaging 0.55
IGL02752:Pik3cg APN 12 32204263 missense probably damaging 1.00
IGL03107:Pik3cg APN 12 32200595 missense probably damaging 1.00
IGL03139:Pik3cg APN 12 32192223 missense probably damaging 1.00
IGL03267:Pik3cg APN 12 32205308 missense possibly damaging 0.94
IGL03367:Pik3cg APN 12 32192121 missense probably benign 0.01
R0112:Pik3cg UTSW 12 32195715 splice site probably benign
R0145:Pik3cg UTSW 12 32204322 missense probably benign 0.20
R0279:Pik3cg UTSW 12 32204791 missense probably damaging 1.00
R0471:Pik3cg UTSW 12 32194771 missense probably damaging 0.99
R0494:Pik3cg UTSW 12 32204546 missense possibly damaging 0.84
R0573:Pik3cg UTSW 12 32197197 missense probably damaging 1.00
R0631:Pik3cg UTSW 12 32205203 missense probably benign
R0699:Pik3cg UTSW 12 32197342 splice site probably benign
R0826:Pik3cg UTSW 12 32195673 missense possibly damaging 0.78
R1076:Pik3cg UTSW 12 32195714 splice site probably benign
R1101:Pik3cg UTSW 12 32195646 missense probably null 0.98
R1459:Pik3cg UTSW 12 32204984 missense probably damaging 0.99
R1625:Pik3cg UTSW 12 32194742 missense probably damaging 1.00
R1971:Pik3cg UTSW 12 32192153 missense probably damaging 1.00
R1992:Pik3cg UTSW 12 32204025 missense possibly damaging 0.83
R2109:Pik3cg UTSW 12 32193710 missense possibly damaging 0.75
R2319:Pik3cg UTSW 12 32176736 missense probably damaging 0.99
R3422:Pik3cg UTSW 12 32204739 missense probably damaging 1.00
R3740:Pik3cg UTSW 12 32205224 missense probably damaging 1.00
R3777:Pik3cg UTSW 12 32194709 missense probably damaging 0.98
R4300:Pik3cg UTSW 12 32176672 missense probably damaging 1.00
R4395:Pik3cg UTSW 12 32204092 missense probably damaging 1.00
R4725:Pik3cg UTSW 12 32193597 critical splice donor site probably null
R4785:Pik3cg UTSW 12 32205199 missense probably damaging 0.97
R4809:Pik3cg UTSW 12 32204081 missense possibly damaging 0.46
R4981:Pik3cg UTSW 12 32204104 missense possibly damaging 0.77
R5033:Pik3cg UTSW 12 32199196 splice site probably null
R5161:Pik3cg UTSW 12 32204978 missense possibly damaging 0.92
R5806:Pik3cg UTSW 12 32204953 missense possibly damaging 0.88
R6136:Pik3cg UTSW 12 32204359 missense probably benign 0.00
R6746:Pik3cg UTSW 12 32194758 missense probably damaging 1.00
R6895:Pik3cg UTSW 12 32204347 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CTGCCTTGCCAGATATCTGC -3'
(R):5'- CCGAAAGTTCAGGGTCAAGATC -3'

Sequencing Primer
(F):5'- GCCAGATATCTGCCACATGTG -3'
(R):5'- GATCAGAGGCATTGATATCCCTGTC -3'
Posted On2015-02-18