Incidental Mutation 'R3421:Soat2'
ID267063
Institutional Source Beutler Lab
Gene Symbol Soat2
Ensembl Gene ENSMUSG00000023045
Gene Namesterol O-acyltransferase 2
SynonymsACAT2, D15Wsu97e
MMRRC Submission 040639-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R3421 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location102150526-102163469 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 102156809 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000023806]
Predicted Effect probably benign
Transcript: ENSMUST00000023806
SMART Domains Protein: ENSMUSP00000023806
Gene: ENSMUSG00000023045

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
transmembrane domain 121 143 N/A INTRINSIC
Pfam:MBOAT 147 497 3.3e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160465
SMART Domains Protein: ENSMUSP00000124628
Gene: ENSMUSG00000023045

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
transmembrane domain 92 114 N/A INTRINSIC
transmembrane domain 134 156 N/A INTRINSIC
transmembrane domain 163 185 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
Meta Mutation Damage Score 0.1648 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Summary:This gene is a member of a small family of acyl coenzyme A:cholesterol acyltransferases. The gene encodes a membrane-bound enzyme localized in the endoplasmic reticulum that produces intracellular cholesterol esters from long-chain fatty acyl CoA and cholesterol. The cholesterol esters are then stored as cytoplasmic lipid droplets inside the cell. The enzyme is implicated in cholesterol absorption in the intestine and in the assembly and secretion of apolipoprotein B-containing lipoproteins such as very low density lipoprotein (VLDL). Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant animals exhibit elevated serum triglyceride levels and are resistant to fatty liver, hyperlipidemia, and gallstone development when fed a high fat, high cholesterol diet. When fed a Western diet homozygous mutant animals exhibit elevated HDL levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T A 5: 114,212,636 probably null Het
Agbl3 A G 6: 34,793,965 T132A probably benign Het
Amn1 A T 6: 149,169,452 L196* probably null Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Armc4 T C 18: 7,223,523 probably benign Het
Atp7b C T 8: 22,028,670 D51N probably damaging Het
Brip1 A T 11: 86,152,669 Y356* probably null Het
Ccdc40 C T 11: 119,234,779 P348L probably benign Het
Chrdl2 G A 7: 100,023,868 C9Y probably damaging Het
Chst4 T C 8: 110,030,406 D192G probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
D930048N14Rik T C 11: 51,654,958 *226R probably null Het
Dmgdh T C 13: 93,711,361 V522A probably benign Het
Dtx2 T A 5: 136,012,478 Y246N probably damaging Het
Fam19a1 C A 6: 96,649,138 D112E probably damaging Het
Gtf2ird1 T A 5: 134,388,500 M518L probably benign Het
Hoxc6 T A 15: 103,010,895 W188R probably damaging Het
Igfn1 C T 1: 135,976,917 probably null Het
Kcnip1 A G 11: 33,645,594 V43A probably damaging Het
Kif4-ps A T 12: 101,146,971 E453V probably damaging Het
Kifap3 T A 1: 163,794,026 I81N probably damaging Het
Mgat4d T C 8: 83,358,143 S172P probably damaging Het
Mr1 T C 1: 155,137,591 Y80C probably damaging Het
Nuak2 A G 1: 132,332,080 D532G probably benign Het
Olfr1230 C G 2: 89,296,553 S239T probably benign Het
Olfr1288 A G 2: 111,478,952 H56R probably benign Het
Olfr20 A G 11: 73,354,634 N294D probably damaging Het
Olfr26 A G 9: 38,855,325 K88E possibly damaging Het
Olfr725 T C 14: 50,034,540 T288A possibly damaging Het
Pik3cg A T 12: 32,204,739 F416L probably damaging Het
Prex1 A G 2: 166,617,854 V124A probably damaging Het
Psmb2 T C 4: 126,677,837 M28T probably damaging Het
Ric1 T C 19: 29,567,590 I230T probably damaging Het
Saysd1 T A 14: 20,082,926 K54N probably benign Het
Slc25a17 C T 15: 81,360,700 V11I probably benign Het
Slc5a4a T C 10: 76,176,573 V359A probably benign Het
Slc7a3 T A X: 101,080,875 probably benign Het
Slco1a5 A T 6: 142,268,238 D52E possibly damaging Het
Telo2 C T 17: 25,110,752 R262Q probably damaging Het
Zdhhc14 T A 17: 5,753,091 *490R probably null Het
Zfp217 A G 2: 170,120,017 F130S possibly damaging Het
Zfp712 C T 13: 67,052,392 V10M probably damaging Het
Other mutations in Soat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02458:Soat2 APN 15 102162115 missense probably damaging 0.96
IGL03093:Soat2 APN 15 102157643 missense probably damaging 1.00
R0091:Soat2 UTSW 15 102158139 missense probably damaging 1.00
R0391:Soat2 UTSW 15 102158753 missense possibly damaging 0.92
R0396:Soat2 UTSW 15 102150707 unclassified probably benign
R1078:Soat2 UTSW 15 102153138 splice site probably null
R3422:Soat2 UTSW 15 102156809 splice site probably benign
R3754:Soat2 UTSW 15 102157078 missense probably damaging 1.00
R4062:Soat2 UTSW 15 102161091 missense possibly damaging 0.85
R4623:Soat2 UTSW 15 102157709 intron probably benign
R5004:Soat2 UTSW 15 102161111 missense probably damaging 1.00
R5808:Soat2 UTSW 15 102154025 splice site probably null
R6481:Soat2 UTSW 15 102162055 missense probably damaging 1.00
R6595:Soat2 UTSW 15 102160593 missense probably damaging 0.98
R6876:Soat2 UTSW 15 102160614 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCGGTACCGGAGCTAATC -3'
(R):5'- TCATGCCTCACTGACACGTG -3'

Sequencing Primer
(F):5'- TACGCCTGAATCCTGGTACTAAGG -3'
(R):5'- TCACTGACACGTGCACCG -3'
Posted On2015-02-18