Incidental Mutation 'R3435:Pbxip1'
ID267150
Institutional Source Beutler Lab
Gene Symbol Pbxip1
Ensembl Gene ENSMUSG00000042613
Gene Namepre B cell leukemia transcription factor interacting protein 1
Synonyms
MMRRC Submission 040653-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R3435 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location89436706-89450952 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89447236 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 354 (L354P)
Ref Sequence ENSEMBL: ENSMUSP00000040429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038942] [ENSMUST00000130858] [ENSMUST00000145753] [ENSMUST00000146630]
Predicted Effect probably damaging
Transcript: ENSMUST00000038942
AA Change: L354P

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000040429
Gene: ENSMUSG00000042613
AA Change: L354P

DomainStartEndE-ValueType
low complexity region 142 152 N/A INTRINSIC
low complexity region 162 177 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
coiled coil region 270 350 N/A INTRINSIC
coiled coil region 379 405 N/A INTRINSIC
low complexity region 672 691 N/A INTRINSIC
low complexity region 692 703 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130858
SMART Domains Protein: ENSMUSP00000118496
Gene: ENSMUSG00000042613

DomainStartEndE-ValueType
low complexity region 149 159 N/A INTRINSIC
low complexity region 169 184 N/A INTRINSIC
transmembrane domain 194 216 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141340
Predicted Effect probably benign
Transcript: ENSMUST00000145753
SMART Domains Protein: ENSMUSP00000121658
Gene: ENSMUSG00000042613

DomainStartEndE-ValueType
low complexity region 142 152 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146630
Meta Mutation Damage Score 0.06 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with the PBX1 homeodomain protein, inhibiting its transcriptional activation potential by preventing its binding to DNA. The encoded protein, which is primarily cytosolic but can shuttle to the nucleus, also can interact with estrogen receptors alpha and beta and promote the proliferation of breast cancer, brain tumors, and lung cancer. Several transcript variants encoding different isoforms have been found for this gene. More variants exist, but their full-length natures have yet to be determined. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A C 2: 68,601,845 D91A unknown Het
Abca9 T C 11: 110,154,430 E359G probably benign Het
Atp7a G A X: 106,094,857 R563K probably benign Het
Dnah1 T C 14: 31,316,674 D150G probably damaging Het
Fam47e T A 5: 92,585,362 V152D probably damaging Het
Gm19965 C A 1: 116,821,623 H345N possibly damaging Het
Ift74 A G 4: 94,621,852 probably null Het
Iqgap3 A G 3: 88,094,604 I384V probably benign Het
Lrrc57 T A 2: 120,609,381 probably benign Het
Mafk C T 5: 139,800,307 Q87* probably null Het
Mast2 A T 4: 116,308,095 S1314T probably benign Het
Mast4 A G 13: 102,787,379 I508T probably damaging Het
Mdn1 T C 4: 32,733,726 probably null Het
Mup6 G T 4: 60,004,116 probably null Het
Neurl1a T C 19: 47,257,525 V532A probably damaging Het
Nod2 A G 8: 88,664,009 R293G possibly damaging Het
Notch3 A T 17: 32,158,618 D161E possibly damaging Het
Olfr3 T A 2: 36,812,678 Q138L probably benign Het
Osbpl3 A T 6: 50,348,070 N149K possibly damaging Het
P2rx4 T A 5: 122,725,070 I202K probably damaging Het
Pld1 A T 3: 28,124,623 M889L probably benign Het
Ppp2r2b T A 18: 42,741,109 Q52L possibly damaging Het
Prob1 T C 18: 35,654,241 E320G possibly damaging Het
Stard13 A T 5: 151,042,179 L937Q probably damaging Het
Strn4 T C 7: 16,837,633 S563P possibly damaging Het
Syne1 T C 10: 5,348,565 D1114G probably damaging Het
Tmem117 T C 15: 95,094,692 I411T probably damaging Het
Tmx3 T A 18: 90,527,904 V203E probably damaging Het
Ttn T C 2: 76,878,718 probably benign Het
Vmn1r209 A T 13: 22,806,097 M141K probably benign Het
Other mutations in Pbxip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Pbxip1 APN 3 89443590 splice site probably benign
IGL02612:Pbxip1 APN 3 89443681 missense probably damaging 1.00
IGL02718:Pbxip1 APN 3 89448004 missense probably damaging 1.00
R0538:Pbxip1 UTSW 3 89447619 missense possibly damaging 0.79
R0549:Pbxip1 UTSW 3 89443592 splice site probably benign
R1460:Pbxip1 UTSW 3 89445614 missense probably damaging 1.00
R1931:Pbxip1 UTSW 3 89447677 unclassified probably null
R1966:Pbxip1 UTSW 3 89445488 missense probably damaging 1.00
R2008:Pbxip1 UTSW 3 89448713 missense probably benign 0.20
R4504:Pbxip1 UTSW 3 89446383 missense possibly damaging 0.48
R4591:Pbxip1 UTSW 3 89446160 missense probably benign 0.33
R5491:Pbxip1 UTSW 3 89443159 missense probably benign 0.09
R6051:Pbxip1 UTSW 3 89443170 missense probably benign 0.08
R6620:Pbxip1 UTSW 3 89447826 missense probably benign 0.12
R7203:Pbxip1 UTSW 3 89447428 missense possibly damaging 0.68
R7259:Pbxip1 UTSW 3 89445633 missense probably benign
X0012:Pbxip1 UTSW 3 89445523 missense possibly damaging 0.91
X0012:Pbxip1 UTSW 3 89446383 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- AACTTCAGAGCCTGTTGCACC -3'
(R):5'- ATGTGACCGAGTTCAGCCAG -3'

Sequencing Primer
(F):5'- TGTTGCACCAGCCCAAAGG -3'
(R):5'- AAGCCCCTCTGCAGGTC -3'
Posted On2015-02-18